blogish

AppleCare Protection Plan for an out of warranty Mac

2010-05-25T13:31:00.003-05:00

Man, Apple is awesome. I purchased an Apple Care Protection Plan last February, days before my computer was out of its 1 year warranty. I thought I had months to register it and promptly forgot about it while school kicked my ass until May. When I tried to register it on the web I realized I was totally hosed, so I tried to call Apple to return the unused protection plan.

To my surprise, after being redirected three times around the various Apple associates I finally got a representative that wasn't interested in refunding my money, but in figuring out if I could actually use the plan to cover my out of warranty Macbook Pro. He sat patiently while I sifted through email receipts from Apple until I found an order number showing I bought my plan while my lappy was still under warranty.

Long story short, he was able to cover my out of warranty Mac because I bought the plan before the warranty expired. Good to know, yeah?

Perl on Snow Leopard

2010-03-02T13:50:00.000-06:00

I just spent the past few hours messing with perl libraries and system libraries just so I could install and utilize the perl GD package to draw line graphs for a bioinformatics assignment (GD::Graph::lines specifically). For anyone that stumbles upon this page thinking that upgrading to Snow Leopard munged your pristine and not frequently used but for that one class all that time ago perl installation, here’s what I did:

Zlib barfed out this error message

Deep recursion on subroutine "Compress::Raw::Zlib::AUTOLOAD"

so I found this article that suggested I clear out all Compress::Zlib files and reinstall. Once I did that I reinstalled GD and Zlib from source by navigating to the directory of the unzipped source and issuing

./configure
make
make install (you may need to add sudo)

Once I got those installed from the perl CPAN shell issuing install GD worked as expected. Hoo-rah.

GumboLabs, or How I Should Learn To Stop Worrying And Always Charge My Cellphone

2010-02-25T21:20:00.001-06:00

I’ve been having hardware problems a lot lately. My car door has been janked since a friend of mine forgot how to put a VW stick shift in reverse and the door bent back on itself, consequently rainwater just pours into the rear drivers side floorboard.

Then my phone fell in the puddle in the floorboard. It still works, but the backlight doesn’t work and it doesn’t tell the right time. I don’t know how the fuck a cellphone that can make and receive calls can’t tell the right time; I’m just a dumb programmer. Lastly, my year old Macbook Pro has a battery that dies at 70% reported charge, so its pretty much gotta be plugged in at all times. I bring all this up because the latter two were a direct impediment to going to an event I really wanted to attend tonight, RubyBayou’s “Holy Shit Rails 3 Is Going To Be Fucking Awesome” talk. At least I think that’s what it was called.

I’ve never been to GumboLabs, so I didn’t know about the doorbell (the phone number they have posted on the door). I left my phone at home today and it lost its charge. I brought it with me just in case after I got home from my calculus class at 7:30. When I arrived very late with the meeting quite possibly over and I saw the sign I did what any good geek would do, looked for free wireless (thanks 48somethingangela for not encrypting your wireless!) and used their very nice patio furniture and started Google Voice texting the “doorbell“ and a friend that I thought was there. When that failed I tweeted RubyBayou and someone who was listed as a NOLARubyist with tweets that indicated they were probably there. Waiting for replies I read the release notes for Rails 3 again (yeah decoupling!) and tried to charge my phone. Until my computer died. With 70% charge.

You guys have what seems to be a neat and unconventional space going on (at least from the outside!) and I’m pissed at myself for missing the meeting, if it in fact still happened. I hope you guys had a good time, and I’ll even try and RSVP for the next meeting!

Side Note: I’m a husband, a full time programmer and a student, in that order (if only I could reverse the order of the last two), and this was simply a little vent at my recent hardware fails and my too busy schedule. I think New Orleans needs a strong Ruby community and I appreciate what GumboLabs and RubyBayou is doing.

If I didn’t have Bioinformatics homework on Hidden Markov Models due next week I’d be having late night hack seshes till the cows come home since I won’t be able to bring the new hotness to the Rails project that’s winding down at my job. Arel looks like the way Active Record’s query API should have worked from the beginning. Holy cow.

The App Store and the Mobile Web

2010-02-13T02:16:00.001-06:00

I read an article today about the Google Voice mobile app and how awesome it is. I can’t disagree, its made me embrace the cloud a few years too late for someone as nerdy as me.

I finally decided on a phone number for Google Voice.

I exported my Address Book contacts specifically for Google Voice, then used the new feature in Snow Leopard to sync with Google regularly.

I even tried using Lala for music without cluttering my work laptop until Apple bought them.

That article really got me riled up though. So much so I resurrected the blog to talk about it. The article, and this one right here, “Will the Mobile Web Kill Off the App Store?”, are both so ignorant of the recent present that I wonder if these ‘journalists’ even pay attention to the articles in their RSS feed they feel obligated to blog about every once in a while.

Don’t misunderstand me, I love webapps. I work on one every single day. They are the definition of portability and they have been ever since Paul Graham invented the Arc programming language to make arguably the first webapp, an e-commerce platform that was eventually purchased by Yahoo. I’m digging the cloud, welcoming our new internet overlords, Google, into more and more aspects of my life. I love the Steam store, never having to save CD keys or even physical discs, keep the proof of purchase on the cloud. Thanks bro. Servers that host your shit for you are just better. People get paid to make those datacenters redundant as fuck. Barring Google or Steam going out of business, I should be fine (Privacy concerns and perfectly rational worries about them outright jacking stuff you legitimately purchased aren’t the point, resistance is futile). Ever since people started using fucking hotmail people stopped worrying about aol dot com or cox dot net accounts and downloading mails and outlook express, this has been a long time coming. But people didn’t seem to want web apps on the iPhone all those years ago when it first dropped.

I bought an iPhone back when they had no apps, had an aluminum back (which I still like better, dings and scratches be damned), no 3g, a shittily designed headphone jack that required special headphone jacks or an adapter, AND cost three times the current incarnation. WITH A CONTRACT. Way back in those dinosaur times, just the touchscreen was enough to make everyone go apeshit. Once the awe faded people started asking the inevitable, “This is a computer, right? Where are the 3rd party apps?” In response, Apple released a 60 page document entitled iPhone Human Interface Guidelines for Web Applications, a starting point for developers that wanted to make webapps that looked native enough and behaved the way you would expect quality Mac software to behave, albeit slow as fuck on Edge. This wasn’t good enough for developers anxious to hack on the NEXT BIG THING and it certainly wasn’t good enough for the tech journalists, most of which couldn’t tell you which end of a try-catch statement to hold. The hackers cried foul and began hanging out in seedy IRC channels and plotting their altruistic and warranty-voiding jailbreaks while the tech hangers-on cheered them on from the sidelines. They were sticking it to the MAN, man.

I don’t know if Apple had plans to release an SDK all along and they were goaded into doing it earlier than they planned. It certainly seems plausible, they announced the SDK well before it came out as if to sate the spuming masses. Who knows. Point is, the mobile web was simply not good enough for most of the fanatics, and more than a few of the great unwashed that just wanted to make fun of Apple’s idiotic foray into a BlackBerry and Palm dominated smartphone space.

I can see the original indignation, the network wasn’t fast and I’m sure people didn’t realize just how much you could do with a webapp and the right mobile stylesheet. HTML5 may have not been production ready back then. I’m sure the idea of the mobile web still carried with it the unflattering idea of the BlackBerry web. I can especially understand how eager hackers would take umbrage that the company that they love wouldn’t let them toy with their new device, despite the added cred and thrill they would get from hacking it anyway. What bothers me are the tech journos.

Here we are, two and one half years from the debut of the original iPhone, two incarnations in, a BILLION apps sold on the app store, more ways to talk like T-Pain and make fart noises than the average consumer knows what to do with. Just a few months ago I read praise for the App Store and desires to see it for all mobile devices, and even desktop/laptop apps. Now that the narrative of Apple v. Google, cage match fight to the death, has permeated the tech blogger’s consciousness though, Google is seen as doing an end-around (WHODAT) on Apple by releasing Google Voice as a webapp. With Javascript and HTML5 it makes the case for webapps once again, and a damn good one at that. Its taken just two and a half years for people to realize that minus the 3g, we could probably have had the mobile web all along. HTML5 has been in development for 6 years under the name Web Application 1.0. But now that the Google Voice app was rejected by Apple, and there has been a schism between the two giants, it paints an exciting narrative for all the hangers-on when Google releases a competent web app for the iPhone. All of a sudden portability comes back into the lexicon, run it on your Droid, your Creepy Blue Eyed Lady Palm Pre, your toaster. These tech journos are all indecisive blowhards that couldn’t even write a “Hello World!” app if I gave them the first three lines.

It took 50 years to run the gamut from assembly on mainframes, to ‘portable’ apps written in C, to ‘true portability’ with the Java Virtual Machine, to webapps. Apple wanted to start with webapps, and the tech journos goaded them into playing through the cycle again in fucking high speed. Good job guys. Maybe next you could enlighten us on the merits of papyrus or stone tablets?

“If I asked customers what they wanted, they would have said ‘a faster horse’.” - Henry Ford

My presentations are on Scribd now

2009-09-29T08:36:00.004-05:00

I uploaded the presentations I gave to the UNO ACM SIGPLAN group last semester to Scribd today. Here they are in all their embedded glory:

The second presentation isn't really worth all that much without the accompanying screencasty stuffs where I use the code generators and code just gets created on the fly. For that kind of presentation, look at railscasts, or the screencasts on rubyonrails.org, they're awesome.

Ruby Intro

Rails

Waow those are some big embed tags.

That's what she said.

Well that was easy

2009-09-26T10:22:00.002-05:00

Pointing my blogger site to an actual domain was really easy. Why didn't I do that earlier? I've owned jorgechao.org for like a year....

Time to do something with buildini.us....

Testing blogging from the iPhone

2009-07-05T15:32:00.000-05:00

If i go into edit HTML I can. But otherwise it's still fuxored.

What do you want from me FOX Broadcasting?

2009-05-23T19:24:00.000-05:00

So it seems that Terminator: The River Tam Sarah Conner Chronicles has been cancelled. No big surprise. I’ve read much better analysis of why the show was cancelled than I could ever hope to write, but its always the same reason these shows get cancelled: Ambitious, complex, no point of entry for new fans midseason. In short, all the things that make some television watchable. Fuck those hangers on that come in 7 weeks into a show because it came on after Idol and are CONFUSED.

Admittedly, I was part of the problem again when this show got cancelled. I didn’t watch until season 2, and even then to catch up I downloaded torrents up to what was available on Hulu, and watched the remaining 10 eps all legal and such. Even still, my Hulu viewership is a drop in the bucket to these vultures because Nielsen can’t even get their fucking web traffic numbers right.

I realized a long time ago that my viewer numbers weren’t being counted because my family wasn’t gullible enough to be a Nielsen family, so it didn’t matter if I watched or not. Shows would get cancelled based on the whimsy of the dumbasses that wonder why they get robocalls all the time (Hint: Nielsen) so why bother. Really, FOX News is consistently the most popular ‘news’ channel, but if you look at web traffic its quite the opposite:

http://www.editorandpublisher.com/eandp/news/article_display.jsp?vnu_content_id=1003963674

MSNBC #1 in March 2009 for unique visitors to their website. Quite a shift eh? Polar. Fucking. Opposites. What’s the cause of this discrepancy? Less and less people are watching things on conventional television and going to the web for their entertainment and news. The people that don’t? They still watch FOX News and American Idol and Survivor. In this television climate, NOT A SINGLE SHOW I WILL EVER LIKE WILL GET RENEWED.

I finally felt like my viewership could be tracked by a site like Hulu. Web traffic? Unique visitors? Websites already do that. How could Nielsen fuck something up like that?

Until this is resolved and people’s web traffic viewership is counted for what its worth, television is doomed to be the piece of shit it has always been. Dollhouse got renewed, but it’ll be cancelled next season. Guaranteed. Fringe however crappy and pseudo-sci-fi it was, it’ll get cancelled because it doesn’t have Idol as a lead in for next season. Lead-ins? Do I really want the success or failure of a show to be determined by a mouth-breather that watches TWO PLUS CONSECUTIVE HOURS OF TV A NIGHT?? Someone that doesn’t know how to work a DVR, or download torrents, or do something as easy as going to hulu fucking dot com for their content? No, and that’s why we’ve been saddled with garbage for too long.

Wow, I don’t even want to look at a word frequency chart for this post. Bombs all over the place, but I don’t know what else to say. I’ll leave you with these little nuggets of hope though:

http://popwatch.ew.com/popwatch/2009/05/is-it-time-for.html

http://www.variety.com/article/VR1118003924.html?categoryid=14&cs=1

Crafty Gits

2009-04-12T14:32:00.000-05:00

I’m taking a class this semester called System Programming Concepts (UNO course number CSCI 2467). The class is ostensibly supposed to be about system programming, duh. It varies how much C programming, csh scripting, awk and sed using, grepping and generally UNIXy stuff is taught depending on the teacher and his disposition. I happened to have it with the lead Bioinformatics prof at UNO currently, Dr. Stephen Winters-Hilt. He’s a brilliant brilliant fellow, and his research in Bioinformatics has made him quite familiar with Perl. So, in this class, we’ve learned some basic UNIX commands, some C (all classic recursively solved problems) some csh scripting, but the real kicker is the amount of Perl we’ve had to learn. It turns out that Perl is super fast because of things like the built in hash primitive and the fact that most of the Perl that people write utilizes precompiled C to make things go faster. Forgetting the fact that your entire program looks like a big regular expression, its pretty neat, and the first problem he gave us on our midterm showed me that I should never trust search in text editors, not grep, or ctrl-f or /string (vi search). They’re all lousy. Here was his problem.

Given a virus genome, construct a Perl script that finds and counts all one base occurrences (a,c,t,g), 2 base occurrences(aa,ac,at,ag,ca,cc,ct,cg, etc.) all the way to 15 base occurrences (1 billion possible occurrences 1,073,741,824 or 4^15).

Once parsing the entire file into a single string and shoving it into an array (1 char per index) the next step is to start searching. His suggestion was to use the wonderful Perl hash primitive to track counts of bases seen thusly:

$my_hash{aatgcgtta}++

I don’t know about you, but I think that’s pretty damned hot. Sexy even. Incrementing the key of a hash so that its value is effectively the counter. NOT TO MENTION, if the key doesn’t exist, in Perl it creates the key, and sets the value to 1. Counters have never seemed so badass.

I’m not going to post my solution, in case someone taking the class stumbles upon this website (not likely) but I will say this: The problem is meant to screw with your brain. Like all good CS assignments, there is a catch that will frustrate you for days to teach you some kind of lesson.

Once I finished my solution to work for 1-base to 15-base cases, I decided to look in the text file itself to see if I was on the right track. I took one of the 3-base occurrences that my output claimed occurred 38 times. I started grepping around in vim and counting by hand. I counted less than 38. Panic-stricken, I thought that my algorithm for constructing strings was totally busted and I had to turn it in incomplete.

The following week I revisited my algorithm because it has to be redone in C and Python now. While looking at it I decided to look at the 15-base case. There was a single base that occurred twice in the 7500 character string, but grepping in the file showed only one occurrence. Perplexed I started at a long string of a’s, c’s, t’s, and g’s for a few hours and discovered that there WERE two occurrences of the string described by my algorithm. The strings overlapped. For example the base:

tttaattaggtttaa

occurs twice in the sequence below. The problem is that the second occurrence is contained in the first.

tttaattaggtttaattaggtttaatttgatgtt
tttaattaggtttaattaggtttaatttgatgtt

See for yourself. Grep, ctrl-f, /search_term WHATEVER, will not find a second string in a search if the second string is partly composed of the first string. Testing my program by using time honored means of text editor search only served to confuse the shit out of me. I don’t know if the lesson to be learned was that you can’t always trust tools provided to you, no matter how old, but that’s certainly what I took from that assignment.

Zealotry

2009-03-23T13:00:00.002-06:00

So I posted a lengthy response to a Computerworld.com news item/blog post about a Steve Ballmer comment about the '$500 Apple Fashion Tax.' I took umbrage and concocted this:

Here's the link for the story. I don't know why it rankled me so but here was my response, printed on my own blog for when it gets lost in the sea of pro Mac fanboyism. I can't believe I didn't put 'FIRST POST' on it. That would have been flamebait.

In the interest of full disclosure: I have a Mac laptop for work/mobile screwing off and a PC running Vista for gaming. I am a firm believer in the right tools for the right job, and I wouldn't be caught dead with a desktop I couldn't upgrade myself (iMac). Also, I think I may like vi better than emacs. Still not sure though.

With that said...

1997 called and it wants its argument back. The standard, demeaning concession 'oh they're great for video/recording music' is so hackneyed and tired. Its like saying the only place one sees a large collection of Mac laptops are on the campuses of expensive art colleges. Have you ever covered RailsConf in your lengthy tenure as a journalist/computer enthusiast?

I assume you've never developed a piece of code in your life, only written about computers in enthusiast fashion for the past 20 years. If you had you'd see the difference in a heartbeat.

Let me put it to you this way. When I began work at an insurance company doing software development they gave me a corporate issue Dell and let me spend my time configuring it. While I was doing that, for 10 hours on my first day of work, I opened up my personal Mac, and started doing development through progress bars, one click installers and constant restarts.

Even if the things you say about price comparison are true today, that zealots are paying $500 for a logo. In that case, lets say I'm a software consultant, and not a paid corporate schlep. If I was billing the typical rate of $150 an hour, the 8 hours I just wasted getting my box ready for real live, big boy development would have COST me $700.

Finally, try building out one of Dell's professional Precision workstations, do all the upgrades to get it to the price of the base model Mac Pro and see what you come up with. I end up with $100 more, and I didn't even include antivirus software. Dell won't let me link the customized model, otherwise I would have. When the Mac Pro first came out I did the same comparison with the 8 core Mac Pro (when that was the base model) and the Dell ended up being $1300 more at the time.

The individual components when customizing on the Apple website scale more cheaply than Dell in most cases, but I guess that would have been too much work to actually look.

I may have drank the Mac kool-aid sir, but looking at your curriculum vitae, it looks like you sold your soul to Gates and Ballmer long before I even took sides on this most ridiculous of arguments.

Ugh. I can't believe I wasted that much time concocting that reply. I didn't even go into the TCO arguments that are always bandied around. It just struck me as old and outdated the arguments he was using, and to buy the party line from Ballmer himself is pretty damn stupid.

Its like they say "Winning an argument on the internet is like winning the Special Olympics. Even if you win you're still retarded." Ooh, what did I just say? Am I going to have to issue an apology like Obama now?

Ruby on Rails on Mac (AGAIN)

2009-03-16T14:41:00.003-06:00

I've set up RoR on my Mac about three times in the past month. I decided to buy a new hard drive for my old MBP. How old? One of the first ones off the boat (February 2006). I only bought it right after it came out because someone stole my old iBook out of my FEMA trailer and I needed a development box quickly. It worked well for a while but I decided to install a new HD because I was worried the old one might give up the ghost on me soon. So with installing Leopard on my MBP, installing the new HDD and now buying my new hotness, the LATE 2008 MACBOOK PRO, I've had to configure a new box for Rails development so many time you'd think I could do it with my eyes closed.

Not that I despise it, the installation is a snap, but there are always a few things I seem to forget, so here they are in the hopes that someone googling around might find it useful (and I know where to look!).

As my friend Luis suggests, the first thing you should do is preserve the Rubygems that come with your computer by setting GEM_PATH to their original location. Follow the link, its crucial in my opinion.

If you are forced to do development using MySQL, you have to do a few things because Leopard comes with PostgreSQL support only. There are two options for this. Download the MySQL 5 package from mysql.com (get the x86-64 version if you have the new hotness), or follow these excellent instructions on hivelogic for how to do it the command line way. Either way is fine, the former gives you a MySQL prefpane that you can use to start and stop the server, the latter gives you some knowledge of what's going on behind the scenes of your MySQL installation, as well as lets you upgrade it whenever there is a new binary rather than waiting for someone to package it up for you.

Installing the MySQL gem seems to be goofy as hell, you usually can't just do

sudo gem install mysql

so what I do is

\m/ sudo su

\m/ ARCHFLAGS='-arch x86_64' gem install mysql -- --with-mysql-config=/usr/local/mysql/bin/mysql_config

Be sure to change ARCHFLAGS to suit your fancy i386 for 32-bit for example.

Finally, JRuby. You can now use Macports to install JRuby which is awesome.

\m/ sudo port install jruby

You still need to set JAVA_HOME after you do this. In ~/.*your_favorite_shell*_profile add

export JAVA_HOME='/System/Library/Frameworks/JavaVM.framework/Versions/CurrentJDK/Home'

and you should be fine. BUT, to install rjb (Ruby Java Bridge) it often gives you a grammatically awful error message, "JAVA_HOME not setted" despite it BEING SETTED. So I usually just export JAVA_HOME directly in my terminal session so that it has an easier time finding that shell variable.

I think that's everything that needs to be done to a Leopard box to do RoR development with a MySQL database and JRuby. I may have missed something, I wrote this at the end of the workday.

Blizzard Downloader Full Client

2009-03-14T18:30:00.002-06:00

This is more to remind myself than anyone else out there (my two readers) but here's the link to the universal WoW Full Client Downloader. I always seem to have trouble finding this link, and after sitting through patches to 3.0 for a day straight (you know how it be) I find this. Sigh.

I tried to run the client with just Burning Crusade installed, then the client reminded me that my account was fully upgraded and provided this awesome link

https://www.worldofwarcraft.com/account/download_wow.html?ST=US-269508-Jwc94ukwGdVlW5trdEtmSMyezjKOXi2qKiQ

I don't have to deal with the tyranny of disks ever again. Huzzah.

Hulu + Content Distributors

2009-02-23T14:40:00.000-06:00

I spent a few hours last night fooling around with an application called boxee, which allows users to have a single point of entry into a wealth of online content via a sleek interface, as well as watching Dollhouse, the new show from Joss Whedon, on Hulu. I was actually driven to use boxee after I found out that it no longer allowed a feed from Hulu after their content providers told them to make the service inaccessible to Hulu.

The thing that attracted me to boxee was its intent to gather all of the streaming web content and put it in one place, controllable via Apple Remote or likewise. AppleTV or FrontRow for the web. It doesn’t do away with the ad supported nature of these services, and it shouldn’t. I’ve made peace with the fact that I can watch streaming web content if I sit patiently through a 30 second ad (I typically just -tab to a browser and turn my sound off but whatever). The terrible thing about these websites run by various content providers is that you have to navigate their awful interfaces in order to get at your content. And they’re all DIFFERENT. Like credit card machines at the grocery store. boxee to the rescue.

Until recently. The creators of Hulu were asked by their content providers to change their service so it wasn’t available to boxee users anymore. What has ensued is the typical cat and mouse game of hackers trying to get around the hacks that the service providers had to put into their pristine software to appease the suits.

Why did they do this? I’ve read many accounts of people making ‘boxee boxes,’ computers (Mac Minis, small form factor Linux boxes) whose sole purpose is to hook into an entertainment center and provide this amazing web content on the big screen. Also, this software runs on Xbox game consoles (hence the name) which are already hooked into entertainment centers, I don’t think this makes the content providers nervous, but it makes the cable providers nervous. They are well aware that they are a dying breed in this age of instant gratification. For example, when I went to MCBIOS this weekend I had TWO 30+ inch flatscreen televisions in my room and what did I do? I watched an episode of 30 Rock (on Hulu) on my 15 inch laptop screen. The TV had no digital cable menu, they merely left me a bookmark on the nightstand that indicated the channels. How quaint. Once I saw that I turned off the TV and put my laptop on the bed to watch me some instant, legal, ad supported Alec Baldwin. I have no interest in channel surfing and I’m not the only one.

This is the future of content distribution, and cable companies and content providers need to learn that its either this or piracy. Dollhouse is a good example.

Joss Whedon couldn’t catch a break with Firefly. It was brilliant, but not enough Nielsen Families watched the show or something so the show crashed and burned. I think Joss has learned his lesson, as evidenced with Dr. Horrible’s Sing-a-long Blog. Hulu has already given a shout out to their viewers asking them to interact with Mr. Whedon, generating juice for the show. When Firefly tanked, the fans had to get vocal to get a movie created that wrapped up the story sufficiently. I hope that services like Hulu will tell the tale of the success or failure of this new show. I didn’t watch the premiere of Dollhouse, don’t even know when it comes on, but I cast my vote and caught up with the show at 1AM last night, at my leisure.

Websites can track site hits, how many times a particular show was streamed, and to what markets, and producers (money-lenders) can see all of this in black and white and see the true numbers of people watching these shows. Hell, they can even see the pulse episode to episode from the vocal minority right there in the comments. I imagine a world where twitter #hashtags are polled as a zeitgeist of public response. If only TV and film executives were listening.

Love and Copyrights

2008-10-12T07:32:00.001-05:00

Money can't buy you love, but love can bring you money. In software the only sustainable way to earn money is by first creating love, and then hoping that some folks want to demonstrate that love with their dollars. - Daniel James

This is some of the most insightful pieces of ‘found wisdom’ (paraphrased from the notion of ‘found poetry’) I think I’ve ever heard. I’d say found poetry, but that makes me think too much about the ‘Unknown unknowns’ speech.

I’ve been planning on writing Yet Another The Book Was Better™ post about Choke, but I can’t seem to get into it. The notion above says more about one of the themes in that book (false love) than I could waste with a whole blog post. It also says a tremendous amount about the software industry (I especially like the part about Ruby on Rails is not a mother fucking industry).

Everyone pirates. Its one of the constants of the universe. As long as there has been software, there have been people that have wanted it, and invariably someone comes along and attaches a monetary value to that software. In the heyday of Richard Stallman and the free software movement, someone would make a piece of software because they wanted it, and assumed that someone else would want it as well, and in the scientific tradition they would share their creations. There was no exchange of money for goods, as it was considered research that would benefit the community as a whole.

Now that software development is a big business there are many obstacles to acquiring software through piracy. But the above statement points out the idea that few in the industry are coming around to, the idea that love for a property will drive people to purchase it. Its not enough to recognize a brand that represents easily copied digital bits, one must love it. From music to movies to applications, this holds true.

I have never purchased a piece of Microsoft software. I’ve pirated, using various means, (including a multi use university license copy of WinXP that I’ve used about 100 times) all M$ software I’ve ever used, barring the eMachines computer my parents bought me when I was 13. Its not a hatred of all things Gates, its a matter of being broke, and just not loving it all that much. I’ve downloaded music, yet gone to a show and purchased a copy of a CD directly from a band member working a merchandise table. Love. The first copy of an operating system I’ve ever purchased was Leopard. Its ridiculously easy to pirate Apple software, but I bought it nonetheless. Love.

When you’re selling something intangible, you have to do a little more than just protect it, and brand it. It has to make people fanatical. They have to feel that they like the company and team of developers that they are purchasing from. That way, it feels like being part of a community through your investment in their product. And in this world of big business and bottom lines, that’s hard to achieve.

(meta)Dr. Horrible's Sing-A-Long Blog, and a Bit on Content Distribution

2008-07-19T10:29:00.000-05:00

So, Joss Whedon of Firefly fame decided to do a no-budget musical about an evil genius played by Neil Patrick Harris. Its pretty funny, but what I find most important is what is says about content distribution.

He got this idea during the writer's strike I believe, an idea to do a show on the cheap to be released on the web, for free (for at time). Its available at this website

http://www.drhorrible.com/index.html

for free until tomorrow.

All three acts are up. I've only seen the first, but I like it so far. The guy that played the captain in Firefly is the bad guy superhero that wants to thwart Dr Horrible. Tell me that isn't just amazing.

The reason I bring it up is that it really says something about the way we consume media. I'm personally sick of awesome shows getting cut down in their prime from lack of viewers, despite the viewers they have being fanatics (Firefly, Arrested Development, the Clerks Cartoon), and this is an interesting way to begin to affect that change. Shows that are created, executed, and published by the creator, not some evil network that only cares about advertising dollars. TV on DVD has resurrected both Futurama AND Family Guy. This is the way I want to consume media from now on. I know its only three episodes, and it was so easily executed because it was done on the cheap, but that doesn’t mean that it can’t be done with a larger show.

Its offered free, then on iTunes for cheap, then as a DVD with speshul features we have come to expect with the medium. This thing could totally suck and I still would have posted about it. It is that important to commercial storytelling. I hope it does well.

This reminds me of the Steven Soderbergh movie that came out in 2005, Bubble. It was a piece of shit, I’ll be honest, but I was excited about it nonetheless.

He released this movie simultaneously in theaters and on DVD. There were no theaters showing it in New Orleans, so I did not get a chance to vote with my dollar. The big three theater chains (AMC, United Artists, and those other douchebags) pretty much refused to show it. It was shot in the foot from day one because theaters were afraid of what it represented.

I did buy the movie from Best Buy the day it came out. There was no theater to see it in, and I doubted Blockbuster would have it, so I voted with my dollar the best way I could. It became a self fulfilling prophecy though, no one saw it in theaters because it WAS NOT SHOWN IN THEATERS.

Its a shame that only big time creators like Joss Whedon and Steven Soderbergh can distribute their content the way they please, but I hope that it will signal a change in the way things are released. We don’t buy encyclopedias written by experts from traveling salesmen anymore, we have Wikipedia. The Washington Post reports on what people are saying in the Blogosphere. Hell, the fact that blogosphere is a word. Information is no longer throttled from the top and trickled down to the pedestrians. Why can’t entertainment be the same way?

Iron Mang

2008-05-07T11:13:00.002-05:00

I have contributed twice now to the Opening-Weekend-Please-Marvel-Make-More-Movies-Like-This extravaganza. Awesome movies deserve recognition, and this is such a gem. See it if you haven’t, my 3 faithless readers. Stay after the credits, the cigarette will that much sweeter after the hot cameo action.

I tend to get a bit too excited when certain movies come out. The cast, the director, the screenwriter, they all come together as some multi-faceted movie masterpiece, or at least I think it will be.

This can be very dangerous.

If Iron Man had sucked on the scale of say, The Hulk, I would have been devastated. It would also have been yet another crushing blow to the burgeoning comic book movie market. The Law of Stupid Movie Goers states that “if you make it, they will come,” and it does not matter how bad, as long as there are enough explosions. But people aren’t all that stupid and they won’t get fooled multiple times. This causes a the Law of Diminishing Returns, one the movie producers pay close attention to. If the sequels keep sucking, and make less and less money, they will actually stop fucking the corpse of the current intellectual property and go find another corpse to defile. (see Batman)

This was such a tremendous achievement for Marvel, they actually announced their plans for World Domination yesterday. Actually, they just announced the comic adaptations in the pipeline at the time, but they’ve pretty much mapped out the next three years of soon to be comic book blockbusters. (Link to M&C rather than the actual Variety article because their site was being retarded)

Here’s hoping that Marvel rides this wave of good fan juju all the way to 2011 with the Avengers movie. If its bad, I will find their Chairman Emeritus Stan Lee, and punch him in the dick. Better yet, Avi Arad, his name seems to be attached to all of the properties, good and bad.

Realistically, all they have to do to make a good Avengers movie is do it like this. That book is so damn cinematic, it makes my teeth hurt. And I think they’re at least giving a nod in that direction with their choice of S.H.I.E.L.D head honcho. Who does this look like to you? Ring any bells, Motha**er?

Hint: Nick Fury was an old white dude in the original Avengers.

I hope they speak English in What.

Lest we forget the Marvel failures: Ghost Rider, Daredevil, The Hulk, Fantastic Four (BOTH of them)

I’m looking at you Avi.

Emacs Therapist

2008-04-24T16:04:00.000-05:00

I had always heard about the therapist built into emacs, but I had never used it. Inspired by emacs wizardry and 9 megs of config files from Aaron, coupled with my desire to try new editors, I started in earnest.

What is the first thing I do? Try out one of the many time wasters built into emacs of course, emacs doctor...

A transcript, only because I never blog, and I need to lower the bar regarding what gets piped from my brain into the blog.

I am the psychotherapist. Please, describe your problems. Each time
you are finished talking, type RET twice.

i am an idiot

Why do you say you are an idiot?

because i'm using a therapist built into emacs

Is it because you are using a therapist built into emacs that you came
to me?

no

Why not?

that makes no sense

Does it bother you that makes no sense?

yes

I see... Well, what makes you believe this is so?

because you fail the most simple of turing tests

When did you first know that I fail the most simple of turing tests?

the first time i spoke to you

Earlier you said you are using a therapist built into emacs?

yes

Yes, hmmm... so, are you sure that this is so?

yes, i am speaking to you right now

Maybe your plans have something to do with this.

my plans of slacking certainly involve you right now. obviously

Do you really think that?

no

Are you annoyed that I ask that?

i am annoyed at circular conversation

Are you annoyed often?

when i am involved in circular conversations

What do you think?

about what?

You mentioned that makes no sense?

i mentioned YOU make no sense

Is it because of your life that you are going through all this?

good. bye.

#########################

Its like talking to a REAL therapist!! Utterly pointless.

Apple Store New Orleans

2008-03-10T08:24:00.005-06:00

So the Apple Store Baton Rouge opened last week. I went. Of course. I stood in line with all the other zealots and got my size XL t-shirt.

Here is a picture of me, and an unspecified red hooded cutie next to me that someone took at the opening. Seriously, I didn't even know someone was documenting my trip to the Apple Store for me. How nice! I had to find out about it on TUAW.com. Crazy right?

And here's the lovely link to the store's website, ASMOL (Apple Store Mall of Louisiana)

Like all other Apple stores in the country, the staff were some kind of hybrid combination of employees from Best Buy and Urban Outfitters, but with Apple knowledge spewing outta their faces!

EDIT: I wrote this about a week ago, but for some reason the Blogger interface was being retarded for uploading images. Now I remember why I use a text editor and upload to the blog directly. WYSIWYG web editors are not my favorite.

Dualing Directors

2008-02-26T11:20:00.001-06:00

So. I’ve been out of the blogosphere for a while. Its time I just said eff it and just throw something out there.

I’ve been thinking a lot about movies (imagine that). Sadly, I never got a chance to see No Country For Old Men, but alas, I’m going to talk about the Coen Brothers anyway.

I don’t think I like the Directors Guild of America (DGA) very much. Way back in 2005, Robert Rodriguez left the DGA to direct Sin City with Frank Miller. Rightfully so, the movie literally looks like it used the comic as a storyboard. From the wiki entry on the DGA:

The rule that a film can only have one single director, adopted to avoid producers and actors lobbying for a director's credit, is strongly defended by the DGA and is only waived for recognized directorial teams (as determined by the DGA)

Rather than acquiesce to their odd rule, he simply quit, something he did previously in 1996 to direct his part of the movie Four Rooms. In doing so, he was unable to direct a movie from Paramount, as they only hire DGA members. Personally I think the biggest tragedy is that he will never be able to direct another Spy Kids movie (Spy Kids 4-D: Back in Time!)

No, seriously, it would have been brilliant.

I think Rodruguez made the right decision. Acknowledging credit for Miller’s work on the film by sharing the Director credit is the best possible honor he could give Miller. This was not a ‘producer lobbying for a director credit’ as feared by the DGA, it was an excellent marriage of vision. What’s more important, vision, or being in a fancy club? Albeit, a club that makes you tons of money...

Which brings me to the Coen Brothers. From the DGA website’s article “Craft Singularity”:

There were exceptions built into the single-director clause of the 1978 agreement...for a "bona fide team."

Never in the history of the Academy Award for Best Director has there been a “bona fide team” that has earned the distinction like the Coen Brothers did this year. Isn’t that something?

What constitutes such a team? Again from the DGA site, they list the Farrelly Brothers (masters of their slapstick craft. Ugh), the Coen Brothers and the Wachowski Brothers. Does being from the same womb ensure singularity of craft? Is that really the entire basis for this definition of team?

From Slate.com’s “Why Not Quit the Director’s Guild?”:

Rodriguez was unable to get a waiver for Frank Miller, who had never directed a movie before, so he quit the guild.

The Academy at one time had some balls, back in 1969 they awarded Midnight Cowboy with a Best Picture Oscar, the only X rated film to win this award. I doubt that the Oscar would have been given to the Coen Brothers had they not received a waiver for being such a “bona fide team,” but I still find it highly significant. Until this film, the Coen Brothers films have been credited as “Directed by Joel Coen” and “Produced by Ethan Coen.” Did it take them 15 years of making movies and attributing them this way for the DGA to finally get over themselves and award them a waiver? Nothing has changed in their directorial style, they have always worked together in writing, producing, editing, AND directing.

I find it interesting that this has generated almost no interest in the issue. Maybe I read too much into things, but I certainly find it interesting that not a single directorial team has been awarded Best Director since the inception of giving away gold statues until just this year. Never mind the fact that the Academy did it for a sanctioned team, I think this means there could be hope that the Academy isn’t the geriatric gaggle of gabbling bastards that I see them as.

On an interesting side note, I turned this post from a lose collection of notes into a real post whilst on the can. Just thought the 3 people who read this would appreciate that little factoid. Fact: The best thinking of anyone, anywhere, ever, is done on the can.

Why "Type-Safe" Languages Don't Cure All Ills

2007-11-26T09:50:00.000-06:00

Whenever I show someone the wonder that is a dynamic duck-typed language like Ruby, they always balk at the idea initially. “Where are my types?” “Won’t that cause a whole world of headaches with incompatible data types?” “Isn’t it safer to use types so that bad data doesn’t get in?”
What if the problem has to do with metric vs. ‘standard’ (i.e imperial) measurements? Types won’t save your ass then, they certainly didn’t save the Mars Observer.

From The Top 10 IT Disasters of All Time

5. Mars Climate Observer metric problem (1998)  Two spacecraft, the Mars Climate Orbiter and the Mars Polar Lander, were part of a space programme that, in 1998, was supposed to study the Martian weather, climate, and water and carbon dioxide content of the atmosphere. But a problem occurred when a navigation error caused the lander to fly too low in the atmosphere and it was destroyed.
What caused the error? A sub-contractor on the Nasa programme had used imperial units (as used in the US), rather than the Nasa-specified metric units (as used in Europe).
I actually remember one of my profs. discussing this very thing in class last Fall, but he wasn’t even talking about dynamically typed languages, he just offered it as an aside during a discussion about types.
I figured I’d post it since I haven’t blogged in months. Woo. So ends the hiatus. Damn microblogging (Twitter) has kept me off the blogspot for too long...

This Is Not My Beautiful Neighborhood

2007-08-24T07:59:00.000-05:00

This is not my beautiful home.

I’ve driven through Lakeview twice since classes have started, and every time, I am confronted with things that surprise and trouble me. Needless to say the house has about a year of overgrowth on it, so its not easily noticeable from the street. Needless to say, things that meant something to me in that neighborhood, family, friends, girlfriend, school, are no longer there. Its one thing when someone grows up and a neighborhood just naturally changes, the inexorable march of Time does a great job of that on its own.

Its another thing when Time replaces the local Coffee & Company with a Fucking Starbucks.

Driving to school yesterday, I noticed for the second time the tourist trap Landry’s Seafood on Lakeshore drive. That place was already lost to me since its change from the fancy Bart’s on the lake, with its delicious hush puppies and The Best Urinal Ever. But still, there was something comforting about Joe’s the chain, with its Applebees cum Jaws aesthetic and shirts making double entendre’s about venereal disease.

I must be falling into the trap that most people from New Orleans do, the belief that the way it was will always be better.

“Change is evil!”

“No high-rises uptown!”

“No riverfront development in the Marigny!”

“Halt all progress! Now and forever!”

But putting locks on the 17th street canal that look like they belong in the isthmus of fucking Panama? That both confounds and astounds me.

5th grade social studies AHOY! Never thought I’d get a chance to use a word like isthmus in anything other than a geography project.

Sidetracked

2007-08-23T09:39:00.000-05:00

(Requisite backstory: I used to have many retarded debates with an ex girlfriend about the nature of art and the merit of digital art programs. Needless to say, being a non-artist, I disagreed with her a lot. Good times.)

I was going to blog about how my old, Lake Pontchartrain soaked neighborhood has changed since I'd last driven through it, but something else caught the periphery of my senses, and like a ferret, I must acknowledge it.

Reading a not so fresh Penny-Arcade (below) it made me think:

Would some artists just cut to the chase and call Photoshop a game in itself, a pale comparison to the reality of actually putting ink/paint to the page?

Would they call Photoshop something like Art Hero?

Would those people be douchebags?

Probably.

Sweet Beauty

2007-08-07T13:49:00.000-05:00

If I was ever going to buy a desktop, I think it would be this one. Fresh, for 2007, you SUCKAS!

I really have no need for a desktop other than to use as a webserver, but that, my absent audience, is beauty. As if the white ones didn’t already look gorgeous. Call me a sucker for brushed aluminum.

Photos imminent

I don't think I have a desk amazing enough to house something so delightful.

The Elusive Mac User

2007-07-30T16:15:00.000-05:00

I’ve read two articles recently from digg about the whole Mac v. Windoze thing, both of them on CIO.com, a site for Chief Information Officers presumably. I read both of them, on my Macbook Pro, using NewsFire, my awesome RSS aggregator that I got along with the rest of Macheist, so they’re not telling me anything I already don’t know. I drank the kool-aid the day I bought my first iBook.

They did however tell me things that are tired and stereotypical. Don’t bother reading the one from the CIO of Harvard Med School, its like 15 pages long. To sum up, Macs are for ‘graphic artists’ and perhaps ‘knowledge workers.’ I don’t even know what the fuck a knowledge worker is, I’m just a dumb programmer.

I, as a programmer and an avid Mac user find these assumptions to be old hat. Take a look at some of the guys on my sidebar. All excellent programmers, and by excellent I mean fucking excellent. I say daily that I hope to be nearly as good as them when I reach their age. All of them, certified Mac freaks. Warms my heart to see that the programming community is making the switch, they’re like a future snapshot of the rest of the computing world in a few years.

What I’m getting at is that the basic Mac user is no longer just a ‘graphic designer’ or a housewife who doesn’t know the mouse from the monitor, they are often some of the most intensive users of any computing platform, the elusive programmer.

I know its a dumb gripe, but I just wanted to continue the voicing of the opinion of a growing portion of the software community that the Mac is a viable platform for everything from rolling simple websites in iWeb, to quickly accessing the ability to roll out enterprise apps.

Hell even German web app developers that make kickass web frameworks use Macs. Weird huh?

That shirt looks good on you, but it would look even better stuffed into the neck of a vodka bottle and flung burning through our office building's window. Let's fucking do it and never look back
-xkcd

Let Play Catch-Up

2007-07-21T17:09:00.000-05:00

I’ve purchased one comic book, nay Graphic Novel, since August 05 (Graphic Novel sounds so much more distinguished :P). Losing letters P thru Z in my collection kinda made me rethink my whole comic book addiction. So, I’ve been downloading comics. Stealing them. I couldn’t afford them anyway, so its not like the publishers are losing my money. Weak argument at best.

So I’ve been catching up on the cliffhangers i had in my bloated folder when the water came. Nostalgia, memory of what my life was like 2 years ago. Crazy that the funny books can summon up those feelings, but it feels like by catching up on those lingering books is one of the best things I can do in terms of ‘moving on’ in every sense.

On to the reviews. Ultimate FF. Crossover. The one with the Reed Richards zombie. Its the basis for the Marvel Zombies book that people feel so strangely about. I had been stuck since 05 on the ish where Ultimate Reed meets Other Reed. I had a lotsa crazy ideas about just what they were doing, none of which were right. I thought that it was going to be Reed from Earth-616 , meaning the regular series. I thought they were going to explain the UFF’s age since they already had an appearance in Ultimate Marvel Team Up. I thought they might put into ‘regula’ continuity the Ultimate Universe.

Nope. Zombies.

Now, set aside cynicism for a minute and think about how NIFTY that is. I think I like unexpected shit almost for the sake of its sheer improbability. Take the Stormwatch: Final Orbit story for example, Warren Ellis kills the Stormwatch station with a crossover/guest appearance by Aliens. The ones from the movie by the same title. How often does a book get some serious, world changing ramifications from crossovers? Almost never, especially crossover from other universes.

I find that anything episodic can easily become repetitive or formulaic without someone, with complete love and reverence for the material, getting in there and fucking shit up old school for a little while. I’ve never been a huge fan of the Fantastic Four. Still not their biggest fan, but I read the Ultimate incarnation. I also have read the Marvel Knights miniseries called simply 4. The reason I read Ultimate books is because they take the old continuity and turn it on its ear, and not being too attached to the characters, and their canonical origins, I can enjoy it. The only reason I read 4, is because it was about the family aspect of the FF. They lose all their money and have to move out of the Baxter Building. Reed becomes an absent minded professor, who forgets to pick up Franklin from school. Theses things interest me. The boring minutiae of life. The things that provide Real Conflict.

The kind guys in purple shorts and funny helmets can’t generate.

http://pharyngula.org/images/galactus.gif

I also finished up Ultimates 2. In the interest of not ruining it, I will say this: If they ever made a movie out of either of those 13 ish stories, it would be pure redundancy. Bryan Hitch would have to be given co-director status a la Sin City. The storyboards would already be done, just look to the comic. The book is already so cinematic in its execution that, while I would love to see it on the big screen, it would be an unnecessary translation. So good.

i’ll bring home the turkey if you bring home the bacon

Late To the Party, As Usual. I Wouldn't Have It Any Other Way

2007-07-12T01:51:00.000-05:00

Just watched the most recent Spiderman. What kind of fan am I, taking my sweet ass time seeing the film right? I shouldn’t have listened to everyone’s criticisms, its not like I listen to them anyway. The general timbre of the comments were of course negative, but I heard one friend say it was the best film yet.

I’m somewhere in the middle. Many leveled criticisms about the execution of the Venom suit and its effect on Peter. Emo haircuts were mentioned. Cheeziness abounds.

I seem to recall the middle of Spidey II having a heavy dose of cheese when he gave up the costume in the middle of the film. Its part of the trilogy character. Spiderman has always been made up of low-rent villains and campy one-liners when fighting said villains. These aspects of Parker in the films contribute to the overall feel of the character. He’s doesn’t even take himself seriously, neither should the audience.

I was a little pissed about how little he wore the fucking mask. Maybe I’ve been reading too many comics that revolve around identities getting revealed and their impact on the character (Civil War, Daredevil) but I mean, come ON. It must be hell for a filmmaker to shoot a character whose masked the whole time, and I’m sure the mask ensures that all of Tobey’s dialogue was ADR’d, but you know what? Thems are the breaks when it comes to superhero movies. Leave the fucking mask on. Seriously.

Probably the best envisioning of Peter Parker has been from Brian Michael Bendis. Easily. He’s one of the best writers of dialogue I think I’ve ever read in the medium. Perfect examples of it can be found in his earlier crime comics in any of a number of interrogation sequences. Pure dialogue.

But back to Parker. Bendis’ interpretation of him is one of an immature kid or man-child (Ultimate or Not-So-Ultimate) whose brain shuts down in panic situations, but leaves the mouth running. Bad jokes while fighting villains are a reflex action. I’ve heard him refer to his boots as booties. He even says tuchas. TUCHAS. I don’t think Cap would’ve called his foot accoutrements booties.

The point of this whole useless review: if everyone would lighten the hell up a bit, they might enjoy some more films of the genre. I mean, how seriously can one take a person in tights?

see, i'm perfectly aware, where it is that our love stands, but the plain fact is that you owe me 8 grand, if it helps jog your memory, i lent it to you on tuesday when we were drinking

Boot Camp Craziness

2007-06-14T09:55:00.000-05:00

Leopard. Apple can sure hype a product beyond belief. Its uncanny. Unheimlich even. I wasn’t that psyched about Leopard until the keynote at WWDC. And now I’ve already got my credit card ready for a hot new student edition of their forthcoming OS. But I’m curious about some strangeness surrounding an announcement about the included Bootcamp that was on the Apple website before the keynote, then was strangely deleted. Here’s the text from the site:

That's right, no pesky restarts to get into Windows. Instead, the Apple menu will have a "Restart into Windows" option, which will put your Mac into a "safe sleep" state, then boot Windows. Over on the other side, you'll be able to Hibernate your Windows install, then switch back to OS X right where you left off.

Interesting! That’d be a neat trick, if only Jobs mentioned it in the keynote. It was subsequently pulled from the site, but not before Ars Technica referenced the quote in two articles here and here. The only reason I remember that bit of copy from the site is that it was one of the features I was generally interested in. I mean seriously, fast restarts? I could get in and out of Windows with the ninja quickness? That would be awesome. Way better than a Parallels or VMware solution, at least, theoretically.

But now, the claim has been stricken from the website! I need to contact my man on the inside who’s at WWDC and see if he knows anything... This is truly more important than a reflective dock and transparent menu bar.

What Scene?

2007-05-29T01:28:00.000-05:00

I was going to blog about how I went to a show put on by the local douchebag at NOLA DIY, but then I started musing on ex girlfriend type crap. Therefore, only this stub will remain. Not going to turn this into a Livejournal. Suffice to say that the motto of the local outfit in charge of putting on shows, ‘no cliques, no trends’ doesn’t exactly describe the timbre of the shows. Not in the least. Never has. I’m too pissed off to continue.

So I stop.

“What scene are you talking about? You try to separate a people from a sound?” - Falling Sickness

I can see why real bands like the Sickness stopped playing this type of BS. Stifling.

Welcome to the Working Week Part 2, Electric Booogaloo

2007-05-24T09:05:00.000-05:00

This has been an informative week. Working with some of the guys from Relevance has been at times interesting, inspiring, entertaining, and a bit overwhelming at times. I mean hell, these guys have been in the game for almost as long as I’ve been using computers, so y’know.... In deference to them, and in the hopes that this tiny blog picks up on their ‘ego search filters’ here goes the name drop. Stuart Holloway and Justin Gehtland are some damn nice guys.

Its one thing to talk to them for 10 minutes a day on a conference call, its another thing to be invited into their lives for a few days. The informal work atmosphere, their helpful attitude when Christian and I would ask the dumb questions that novice programmers ask when dealing with an awesome dynamic, web-based, framework like Ruby on Rails. Hell, I even saw Stu do some meta-programming to improve test coverage for any method that overrode to_s. It never worked 100% but the theory will stick with me.

That’s the kind of thing I will take with me from this working experience. The mentoring is priceless. Thank Jeebus Gray Insurance is footing the bill. I don’t want to know what they charge for training.

Enough gushing, Now to talk about my new Twitter addiction. I found out about Twitter from reading some of the Rails community blogs/news tidbits/mudsligings, so I thought I’d give it a try. After all, its built on Rails.

In a concise, hyperbolic Twitter style paragraph it is:

ADD Blogging.
Blogging on Speed.
Something Else Buzzwordy.
Rails-A-Licious.

It appeals to me on some kind of subconscious level. Now that I have Twitteriffic.....Sweet Christmas. I use it at least twice a day. I don’t know if the desire to update strangers on what you’re doing regularly is why I do it, or if I have such an ego that I think that people care, but often times other people’s activities or musings on them can be funny, poignant, or informative. I know that I’m probably saying what others have been feeling for the duration of the service, but still, its true. 140 characters to express oneself is harder than it seems when used to blogging. But when there’s no time to blog, or what is going to be said doesn’t warrant a whole blog, it gets Twittered.

Speaking of the Rails community, being up in NC I got a taste of what people who belong to the ‘community’ think about. I had read about some kind of ‘beef’ if you can call it that between DHH and Alex of Twitter about whether or not Rails could scale to multiple databases, and it had been discussed at dinner one night. After all, almost all of the guys had just come from RailsConf, so they were talking about how the outside world viewed the ‘community.’

The Greater Good. Heh.

Wow, That really felt like Meta-Blogging. Blogging about blogging......twittering. I guess I need to blog more often so that when people Google me, they won’t end up with search results about Elaine Chao. Or do something amazing. The amazing Jorge........

I like the sound of that.

No I did not mean to search for Jorge Cao.

Hell, Its About Time

2007-05-19T18:17:00.000-05:00

Starcraft II. Damn. Like any good RTS fan, I’m all about this like a Zerg on a Terran’s fayce. Damn spellchecker just doesn’t understand me. I’ve watched the gameplay videos. I’ve read IGN’s coverage. I’ve even photoshopped “Hell, its about time” onto the SCII logo for a desktop background.

I can’t deal with Blizzard’s trademark answer to the question ‘when’s it coming out?’

‘When its done.’ Period. Damn perfectionists. At least their programmers don’t have to labor under unrealistic deadlines. That’s cool.

I need to update this thing more often. I don’t really. I’ve been too busy Riding the Rails. Oh, Rails, you make coding fun! Who would have thought that an insurance company would be so forward thinking about their Bond Management software, to make a web-based application using a Object Oriented scripting language with a web-development framework that’s only 2 years old, and was designed by a 26 year old. For reals.

As said by the now effigy-ed Tychus Findlay, ‘Hell, its about time.’

Enough, I’m going to buy Starcraft ONE.

Welcome To The Working Week

2007-04-16T06:56:00.000-05:00

More to come

100 Best Comics Since Before I Was Born

2007-03-18T19:41:00.000-06:00

Wizard got this brilliant idea recently (and by recently I mean May 2006) to make a list of what they feel are the best 100 single issue comics of the last 30 years. I didn't read the article, I only know this because someone went through the trouble to find all 100 issues and compile them in a torrent, for my very own downloading pleasure. Nice.

Now, I'm not a huge fan of "Best of" lists. I'm certainly not a fan of the AFI '100 Years, 100 Laughs' list. I mean, I find transvestite humor as funny as the next guy, but Tootsie; To Wong Foo: Thanks For Everything, Julie Newmar; and Some Like It Hot are all in the top 10, with Some Like It Hot being #1. Not a great list, in my opinion. No one will totally agree with anyone else's list, but at least they can give one some ideas for viewing/reading material worth looking at.

For the most part the list has some staple books on it. I've tried not to peek at the top 10 comics, as I am reading it from 100 to 1, like a countdown, one that will take days. So far, I've seen The Punisher, Daredevil, Batman, Jessica Jones of Alias fame, some book called Legion of Super Heroes (twice!), but every once in a while I run across something like this.

Ugh. Do I HAVE to read this? My OCD compels me to. I don't know if I can do it. This always ends up happening. I have this crazy desire for complete-itude and so I don't skip it. I just put the whole compendium down, and forget about it. Regardless, it's a good list, it makes me want to read more of the ones that stand out.

UPDATE:

My brain still hasn't adjusted to the whole Y2K thing, I never got the firmware update I guess. I just realized a list of comics that spans the last 30 years limits them to 1976! Goody, even though the 80's had some absolute shite, at least all of the 60's and most of the 70's Silver Age bullshit is stricken from the list. I guess I won't have to skip around as much as I initially thought.

..........

2007-03-09T05:36:00.000-06:00

I swing from the highest tree, lynched by the lowest branches of me, praying that my physical will set me free, because I'm afraid that all else is vanity, mere language is profanity...
-Saul Williams

A Fire Inside................

2007-02-05T23:21:00.000-06:00

I’ve gotta start doing timely posts like this. I feel like talking about the Aqua Teen Boston Bomb Extravaganza, but that was like, SO 4 DAYS AGO. So instead I’ll recount the evenings events, in the interest of being punctual with my news.

Arena rock. Black costumes. White instruments and amplifiers. Front firing floodlights flashing in tune with the drums. A song that sounded like Guns and Roses SO GODDAMN MUCH I was singing “I don’t need no civil waaaaaar-ow” as loud as I could. This is what AFI has become.

At least Sick Of It All was good.

At least I didn’t pay. Thank you, Canada.

So they went from this

to this???

Fashionable indeed.

Wow. Kids these days. I’m not one of those people that’ll stoop to saying things like “fucking all ages show!” cos I certainly enjoyed my fair share when I was a wee one. I remember being at the Shim Sham Club (One Eyed Matador’s) and having to stay away from what I lovingly referred to as the “big kids table,” A.K.A the bar, and instead being relegated to the dance floor and a single table with a pitcher of ice water for all the dancing children. I remember taking the bus to go downtown to see The Toasters and Mephiskapheles play at the House of Blues, and being denied entrance. All ages shows are an important part of a scene that is comprised of young fans.

BUT JESUS. It’s always sad to see a band denounce it’s roots in favor of popularity. It reminds me of a conversation I had with a local DJ who stopped playing the Drum and the Bass in favor of something more “danceable.” He’s not a millionaire, but he’s compromising his taste to again be in the favor of the fans.

A performer is not the same thing as a musician apparently. Who would’ve known. I feel so naive.

“I’d like to play me latest chart topper, it’s called ‘Me Fans Are Stupid Pigs’.” -Bart Simpson
Thank you Against All Authority, for being so close to AFI alphabetically that I was forced to find solace in your rock sauce.

At least Sick of It All was good......

Zombies

2007-01-24T02:26:00.000-06:00

I like zombies. Not in the Quisling kind of way (read the part about World War Z, unless you REALLY want to learn an obscure new word that just means traitor), but in the way most consumers of popular culture since the remake of Dawn of the Dead have been. Here’s where I flex my old school muscle and say I’ve been a fan since I was old enough to seek out Romero’s films, how cool am I?

After listening to the audiobook for World War Z, I sought out the book so I could throw a little monetary support to Mel Brooks’ kid, you know, cos they like that kind of thing. Money I mean. Not that the film deal with Brad Pitt’s production company won’t bring him plenty of that. I’m in a tangental mood tonight, I couldn’t even tell a cohesive story to a coworker without derailing myself about 20 times tonight.

After reading the book, now I’m hooked on Robert Kirkman of Invincible fame’s new zombie book, The Walking Dead. Go here for a #1 of both of the books I just mentioned, they rock. This begs the question, what’s the fascination with zombies? It’s not just me, all these things are within 5 years of each other( Dawn remake, 28 Days Later, Shaun of the Dead, WWZ, Walking Dead) so somebody else must be thinking about these things too.

My manager asked me what me and my fellow consumers fascination with Zack was all about. All I really could say was that it’s been in the public consciousness since the 60’s thanks to Romero, and that people have a tendency to have a bit of an obsession with things that scare the crap out of them. I could never have formulated such an eloquent and apt description as Simon Pegg has in the afterword of book 2 of The Walking Dead. Unless of course I was hot off of the set of my genius zombie satire film and was asked to write an excellent afterword for an equally excellent book about zombies. Then I coulda nailed it.

Now I’m off to continue my obsession with consumption and classism by watching more of season 1 of The O.C. It’s like the 24 of primetime drama. And I fucking mean that. I don’t just toss Bauer’s name around. I’d be too scared to see what he’d do to me if he found out.

Broken Cars and Broken Dreams

2007-01-21T12:46:00.000-06:00

Just when everything is starting to make sense in my life. Finally, TRULY single, not enrolled in school so I can figure out my life, and WHAM. Volks spins out of control due to a tire blowout on I-10W into some nice old people who were good friends with my surrogate grandfather, Paquito.

Funny how life works. Nice people really.

So today begins my self imposed car probationary period. I can’t afford the raise in insurance, and am tired of asking my father to pay for my fuck ups.

Insurance rates drop at 25. Guess when I’ll stop riding a bike? It’s better for the environment anyway. Better for my cardiovascular system.

This human is a pipe bomb.

It sure did look nice

Tabbed Browsing: Why I Love It, An Ode To The 21st Century Equivalent To A Dictionary At The Head Of The Bed

2007-01-21T02:15:00.000-06:00

Tabbed browsing. I use it. I tout its virtues daily, mostly to people who don’t really care anyway.

Today I finally realized why I love it so much. I use those tabs as a way to keep track of the things that I have been doing/researching over the day. Usually what will happen is I will get more than a web browser’s width worth of tabs and I will trim the fat, much like I store the text messages from people that I find funny and such. I was looking up the so called “War of Currents,” the struggle between George Westinghouse and his Alternating Current versus Thomas Edison and his Direct Current, when I realized that it was all Sarah Vowell’s fault.

Other topics I perused while reading Assassination Vacation: The soldier who wouldn’t surrender, and the Russian view of Nihilism as a political movement, Nardonik.

The reason I keep the tabs open is so that I can remember the weird shit that I look up while doing something like reading or web surfing. Now I realize I have a repository for all those weird links besides my del.icio.us, my own personal journal.

By today I mean December 26, that’s how long it takes for my ADD addled brain to remember to do things.

I Was In Da Moovies!

2006-12-18T19:50:00.000-06:00

It sure was cold back in 1918. It must have been because the world was not heated by the fires of the Brad. People ask me if I saw Brad. I tell them he wasn’t born yet in my particular scene.

Cold. It was terrible. But I got a pair of thermal under-leggings out of it. I brought a whole slew of things to occupy my down time with, and ended up using none of them. Laptop. Comics. A book without pictures (Chris’ idea. Bah). They remained in the bag. The one thing I wanted to bring, my Electric Blue Nintendo DS, stayed at home. That would have been the thing used most between takes. I could have hid it in my WWI-era trousers and drew some rainbows in between takes. Gotta remember that if there is a next time.

Three angles of one scene took the whole 8 hours. Jason Flemyng running through 1918 style post WWI revelers in the Pedestrian Mall in Jackson square. Two overhead crane shots and a long dolly shot. It was nice to see the mechanics of the filmmaking process laid bare like that. David Fincher sitting in a black tent watching replays of each take on three big LCDs. The DP framing the shot using the same LCDs from inside the tent. I guess that’s how movies are made when studios have lots of money to throw around. Or maybe it was just too cold. Who knows.

The Curious Case of Benjamin Buttons isn’t even slated to come out until 2008, it must takes a long time to put the head of an old man on the face of a tiny boy. In the meantime, since you won’t be able to see my beautiful face in all it’s cinematic glory, here is the screen test that got me in the pitchas. Good thing I had a MacBook Pro handy, and a stolen copy of Quicktime Pro to do a video capture. Otherwise I might have never been as famous as I am today.

Would I do it again? 75 bucks and a free meal for a whole lot of sitting around and the chance to watch a movie get made. For a poor college student who has an above-average obsession with movies?

Sure.

Apocalypto

2006-12-06T04:18:00.000-06:00

Fuck you, Mel Gibson.

Just came from a screening of Apocalypto, the Gibson opus about the decay of a multi-goded society named the Mayans. If only they let Christ into their hearts, they might not have been such heathens.

What merit did this film have? Was it shot well? Slow motion and forest. Oh, and gore. Not a single discernable, or memorable shot throughout the film. That of course did not stop a pretentious fuck leaving the film to compliment the way it was shot, because most people cannot dispute that. They can only nod along, not wanting to sound like the fool who does not understand cinematography.

Was it accurate? I’m not a Mayan expert, but some appreciated its accuracy in terms of the total decay of the society from the inside out, a commentary on the fact that the society was not conquered by Spaniards, but by themselves. The only problem with that is the same person who appreciated it’s “accuracy” also commented on the fact that the conquistadors who appear at the end of the film, signaling that the terror is over, came around 200 years early. Much love for the accuracy.

I gots no love for a film that has a string Gibson motive permeating it. I got the sense that I was supposed to feel sorrow for the heathens, but at the same time, there is a culture falling apart from the inside on display, complete with Mel’s characteristic flare for snuff. Based on his crazy Christianity, the only conclusion I can make is that he believes that the culture was flawed completely and us Europeans killing them and bringing disease and our one god saved them. Crazy bastard.

Did it have good pacing? The entire third act was a goddamn chase scene. Complete with live birth, impalings, more chasing, a Fugitive-esque drop down a waterfall, and finally, Christians. Goody. My kind of snuff.

That flick made me damn angry.

I’m out.

Awake

2006-11-15T10:10:00.000-06:00

New apartment. Same bedroll that was my consolation prize for losing my entire home and all of my childhood memories. It is a nice bedroll, however. My battery is not full and I need to urinate. The crack in the window in my new room let some of the rain from last night in. Next to me are some comic books, some DS games (comfort items), most of my clothes, my trusty bag, and a “hurricane” lamp lent to me by Chris. Bland observations.

I feel like a squatter sleeping in a house without power. Especially sleeping close to the ground on the aforementioned bedroll.

How is this any better than the FEMA trailer? Good question. It turns out I am a squatter with internets. FeatherByEarthLink is free in this area for New Orleans residents apparently.

Yesterday felt like some kind of a great cleansing, collecting my things from various nooks and crevices in the trailer. It felt like I was moving out of a hotel room. The transience of the trailer was/is an odd feeling. Despite the new house having all the accoutrements of a normal house, or even a fully loaded FEMA trailer, when I was packing I had the sense of excitement and abandon one gets when moving. We are indeed Moving On Up.

I really hate talking about myself. I want to talk about a special edition, Japan only DS Lite. Crystal White, Final Fantasy characters etched on the outside. Beautiful. THREE HUNDRED DOLLARS. They get all the cool stuff in Japan :<.

Wii. Spellcheck, one day you will recognize the validity of those three letters strung together. If we don’t have power by Wii Day, (Nov 19) I may have to jack someone’s house/tv/electricity. I cannot wait to feel the Wii-Mote Nunchaku beneath my fingertips.

Hyperbole for breakfast.

Time to urinate.

Success

2006-09-14T22:56:00.000-05:00

The accomplishments of the successful in history can be based solely on them having a wealth of leisure time.

I don't care if it's been said before.

That is all.

-J

Elitism?

2006-06-26T23:30:00.000-05:00

I’m gonna try not to sound like an elitist bastard, but it’s going to be hard.

I was sitting in the parking lot of a gas station in Algiers in My Fair City(tm) and a Friedmanly(?) idea came to mind. I saw this geto (i spelled it right) white boy in an SUV drove past in the “i’ve never driven a manual automobile in my life” pose. It immediately hit me, the idea of the decentralization of fashion centers and trends, and the lowering of “the bar.” I will explain.

I had just noticed a big fuggin truck driving in the Quarter, and Marcella said something to the effect of it being a stupid choice to drive in the Quarter, since it’d be a bitch finding parking. So I began to wonder where the trend of big ass trucks and SUV’s came from. It couldn’t have been from one of the traditionally viewed centers from where culture, fashion, and trends came from, since it would be massively inconvenient to have such a beast. Marcella pointed out the desire to have excessive things could very well be the cause of this, similar to having pets, but I think it goes further than that.

The utilitarian need for these types of vehicles says to me that the vast masses of people in the great unwashed middle of this country popularized the notion of a utility vehicle (sport or otherwise) and thus have a say in what becomes “popular.”

Here’s where I sound like an asshole.

This is bad.

The proliferation of technology, having the Friedman flattening effect, has allowed people in the rest of the country to have a say in what happens in terms of trends and popular culture. 100 years ago, people emulated the popular culture of the time, i.e things they thought people in cultural hubs did in their spare time; going to the theater, consuming intelligent books, and the like. I believe vast highway systems linking the country, plus radio. plus television, plus the GODFORSAKEN internet, has flattened the consumption of culture.

What’s so bad about that? Isn’t blogging the coolest thing since sliced internet? The whole democratization of information has allowed people to be their own muckraking journalists, and that, my 3 friends, is the key to getting us out of this slump. But observe popular culture. What do people find “cool?” What is on our televisions? What novels populate the shelves of Wal-Mart and grocery stores, traditionally well renowned centers of learning?

People in the media must now pander to the great unwashed, because they know what they want, because people don’t tell them anymore. And now that people are able to consume things that indulge their most base feelings (complete violence/badass-osity, humiliation i.e reality t.v or Springer, Rush Limbaugh) without fear of reprisal, they do it happily. Look at our president. The intelligentsia stopped having a big say in who gets to be president, and who gets to be a congressperson(Dems ran it for 40 straight years) and we get Newt-motherfucking-Gingrich, and good ‘Ol Bush.

No Bush bashing here, I’m not hip enough to do that. Just commenting on the so called “cultural divide” or “red state v. blue state business.

It has to get worse before it gets better.

There are tons of good reasons why I’m not living on a fucking mountain, bereft of all the tech I find good and holy in the world; simply put, I like it. It has the most massive potential for good. For reals. My utmost hope is that people realize the power they have, realize the fact that they’re active participants in this society, realize what they consume has an effect on the world as a whole.

Blogging is a good thing. Getting one’s thoughts on paper is good. Fuck, e-paper, whatever, it’s better than texting someone something that a 4th grade teacher would give a big fat F for in grammer. Airing one’s personal shit online, people getting pissed about not being on someone’s “Top 8” on fucking Myspace, not a good thing. These things take time. I really have no faith in humanity, so I don’t know why I think it could possibly get better, why I think people will vote with their dollar, and not on American Idol, but I’m a fool.

Hell, I think the $100 dollar laptop ***olpc*** will work as intended, and not be a huge item for black market ripoffs and further resellings, so how dumb am I right?

Just another self loathing, elitist geek, who simultaneously reviles and wants to coddle humanity.

Wow, Red Bull makes my hyperbole show like a dog’s engorged lipstick.

Done. For reals this time. I gotta watch me some Arrested Development.

Ooh Shaa, No Sha NO

2006-05-09T19:36:00.000-05:00

The rear windows leapt up with a touch, like frogs in a dynamite pond

-HST

Certainly an apt description when describing how blindingly (i almost typed blingingly. heh) fast the windows rearrange themselves, exposé style.

I am truly a Mac convert now, I don’t rely on benchmarks that give a numerical value to the sheer 3d processing power my computer can output, all i care about is that it resizes my windows in an expedient manner, EVEN WHEN I am reading comic books at the same time. Important, Quite.

I wrote that stuff like 5 days ago when I installed new memory in my MacBook. That’s right, there are even instructions in the “getting started” manual they send you with the computer. UPGRADABLE MAC? LAPTOP? omg man, omg. My mind is blown regularly by those geniuses up in Cupertino.

I may as well just change the name of this blog to MalcomOSX, given the amount of webspace I give those fuckers. I’m thinking about a haircut, lemme know what you think about it.

I really don’t want to read Once Were Warriors, I’d rather shoot heroin into the head of my penis, but alas, I must fulfill my literary obligations before I get to partake in the recreational.

I think you know what I’m talking about.

BOOT CAMP BITCHES!!!!

2006-04-08T16:44:00.000-05:00

So, anybody out there with one of those sweet new MacBook pros just itching to play something other than WoW? I know I am. A fucking Radeon X1600 in a pci-x slot? The video card is better than the one on my home computer!

Enter Boot Camp, Apple's dual-boot solution for peeps who want windows on their Mac. Why? DAWN OF WAR ON MY FUCKING MACBOOK THAT'S WHY.

Apple is the coolest fucking company that was ever created. Now people can switch to Mac with the knowledge that they can still have a Windows lifeline. Not that they'll ever go back. Except to play Dawn of War that is.

Off to Boot Camp. My Mac shall emerge...............................
.
.
FOREVER CHANGED

Hoo......

2006-03-15T13:31:00.000-06:00

It appears that the creators of Penny Arcade have “made the switch.” Two of the webcomics biggest geek gamers, bashers of the beloved platform, now they see the light. Makes me want a MacBook even more, cause apparently they can rock “teh wowz” probably better than my box.

This is what I mean when I say that geeks need to learn that their deep-seeted views tend to bite them in the ass, EVENTUALLY. I used to be that kind of geek. I used to hate the Macintosh. I used to hate ATI videocards. I still don’t like Intel that much. Yet, I own an iBook, have an ATI Radeon 9800 in my PC, and can’t wait to get my hands on an Intel based Mac.

The strangest thing about tech oriented geeks having canonic points of view is that THINGS CHANGE. In the realm of ever expanding computer technology, things change almost daily. So to base some kind of fanatical iedas on such a shifting realm has ceased to make sense to me. So I don’t do it anymore. It makes one look foolish. I was one of those geeks who would get all confrontational when people even uttered the word Apple. The funniest thing about the Apple bashing I endure in the CS lab is that as soon as the grad student who owns a iBook enters, IT STOPS. They aren’t so steadfast in their anti-Apple beliefs that they would take on a grad student in a PC v. Apple debate.

If I don’t keep my headphones on before English class starts, I swear to god I’d probably pull a Patrick Bateman on the loud girl and the kid who paces the front of the classroom doing weird shit for the sake of being weird. Not to mention the kid with the deep voice who’s pre-class pseudo English major analysis really bugs me. I’m really happy there aren’t annoying people in my major. HA HA.

Tyler Durden Was Wrong

2006-01-31T09:46:00.000-06:00

“We are the world’s lost children. We have no Great War. No Great Depression, We are the middle children of time.”
-Tyler Durden

Sorry guy, but if these slacker post-moderners paid attention to anything they’d know that the next revolution is a global one. And we as Americans are just as blind as Mr. Durden to see it.

Globalization.

And if we don’t wake up to it, and learn to compete with the billions of Indians and Chinese, we are doomed to lose. So keep writing books Mr. Palahniuk, until the smash bestseller from Xiang Chiang comes stateside and blows your shit off the shelves.

Why am I such a fatalist? Damn you Thomas Friedman. Ya scarin tha kids!

WHY?

2006-01-27T09:16:00.000-06:00

WHY? (i’d give a better link but the anticon site sucks) doesn’t sound like TMBG like Marcella claimed them to, but they sure make me want to listen to They Might Be Giants. Is folk-hop the right word? That’s what the anticon website bills them as, but I hate those fusion type labels like high-pop, or trip-hop. Those words just bug me. Not because I’m one of those types that think music is too diverse to pigeonhole, or any of that bullshit. It’s just that when people try to apply labels to something genuinely different sounding to describe it, it just doesn’t ring true to me. Compare artists to other artists, that’s the best way to describe music to people who haven’t heard it before. Folk-hop. What the fuck is that?

Here goes my review: WHY? has a similar voice to the guy from The Postal Service, plus the flow style of Beck (I guess that’s where folk-hop came from?). The tracks are very diverse, so a TMBG comparison might be valid, but I’d say no, cause it has a slight tinge to the anticon hip hoppy style. Acoustic plus downtempo beats like Mirah too. Except no female vox.

I couldn’t do it, I had to reference genre. But it was only to reference a particular facet of the group/label. I am a failure as a music critic.

Regardless, I’m diggin it.

The coolest thing about iTunes is how when it’s not on shuffle, it invariably goes to the next artist when their cd’s over. And thanks to the wonders of the alphabet, WHY? segues into Wu-Tang 36 Chambers. How nice.

Non-Live Journal

2006-01-22T03:40:00.000-06:00

I can’t believe how readily available journaling/blogging/’airing one’s personal, drama causing shit’ software is. At least compared to journal-type software for one’s personal use. Because, you know, what’s the point of a journal unless all your friends can read it?

MacJournal. It’s pretty nifty. In fact, this post is being edited from MacJournal, then will be uploaded directly to Blogger. For no one to read there too. Of course I opted to not use the software for a 15 day trial. 15 days isn’t long enough to evaluate software, so I looked in my Serial Box and found a cracked serial to try it out for a while. So far I love it, and will probably pay for it, since one day I hope to support myself by writing software.

The reason I want this journal app is not to write sappy poetry ‘too private for the internet.“ Actually I’m going to use it like I wanted to use iCal, to keep track of school assignments, notes and whatnot, complete with the link service I so love and use on my blog. The nifty thing is I can make hyperlinks to files stored on the computer within the entry, so for example if I’m waxing geeky on a programming assignment, I can link the relevant file so I don’t have to go hunting for it. It seems my transformation into a Mac fanatic is complete. I can’t even be bothered to click a few times to get to the file in Finder. I require colored text encircled by thoughts about said file, complete with a timestamp for the whole shabang.

After the hurricane, I had a shit ton of momentum built up about performing well at UNO, which I attempted to carry over to LSU. While I ultimately did not complete the semester there for many reasons, I was experimenting with using my laptop productively at school, for classes other than Comp Sci. I began taking notes in class using TextEdit and filing them away with the dates in class folders. I put my schedule of classes with room numbers and building names in iCal so I’d remember where I had class on that massive campus. I even put the reading assignments and other homework items in iCal so I’d be more inclined to do them. Links to class pages and related things were in a special class links folder in Firefox. I figured that since every August we get bombarded with advertisements from Dell saying that Junior will be the hippest kid in school and do really well in class to boot if he has a laptop, that I might as well try and use my baby as a focus for all my studies, not just Comp Sci. MacJournal is the thing I tried to make iCal be. And it rocks.

The locked journal on my comp is where my Emo songs go, so ummmmm, if you’re ever on my comp, DON’T LOOK THERE!!!

James’ car is broken, and I’m in Orange County writing this on the way to a party in NO, so I’m out.

You Say Red Beans.....

2006-01-16T18:23:00.000-06:00

I say culinary abortion. Now I know why they package Tabasco sauce with those MRE's. The red beans and rice with 'cajun style' sausage cubes I just consumed was so awful. Not even Tabasco could fix them beans.

Reread A Scanner Darkly in anticipation of the movie. I can't believe I'm really looking forward to it. The idea repulsed me when I first heard of it. When I saw Keanu in all his interpolated rotoscoped glory (the thing they did with Waking Life, drawing over filmed footage) scared the bejesus out of me. I even bought my own copy finally so that I wouldn't have to get one with Keanu lookin like 'whoa' on the cover. But the more I read about it, I think it might be ok. Now I don't buy this bullshit that the CG technique they used (interpolated rotoscoping) was to 'evoke a haunting vision of the future' or whatever. I know Richard Linklater directed Waking Life too. This is just him wanting to use that technique again, but I've made my peace with that.

When I read things, written by Dick's own daughters, like the fact that the afterword in the book is also included (a really sad musing about drugs, likening it to kids playing in the street, followed by a list of people drugs killed or impaired that he knew, Phil also appears on the list) in the film treatment, I think it could be better than Paycheck. Sweet all knowing pink laser in the sky, Let It Be Better Than Paycheck.

Besides, the scramble suits will look much cooler this way, and not so out of place.

On the non-fiction tip, The World Is Flat is my attempt to make it on the dean's list this semester. By reading about the kind of tech-related jobs I desire when I finish school being outsourced to India, I get scared. So in order to compete with the 225,000 grads that India churns out every year, most having CS or engineering degrees, I am angling to be one of the best geeks UNO can produce.

Financially opress a large nation for long enough, they get hungry. Hungry for American jobs that rich CEO's who want to make their stockbrokers even richer are more than happy to outsource. I don't want to be a Tech Support phone jockey. But these guys are moving up the production chain on the regular. Some of them do the actual R&D for these software companies, not just the data entry, or code monkey jobs that I could also do without.

Maybe I should've listened to Mustafa Starwars, Bengali(an Indian dialect) is the most spoken language in the world. Being that one billion people speak it, Maybe I should take that as my foreign language.

Bangalore, HERE I COME!!!

Baton Rouge Is A Desolate Wasteland

2005-12-29T13:08:00.000-06:00

However, this be some funny predictions about the interweb for 2006 from a guy who works on the fancy Firefox web browser.

Currently reading Gödel, Escher, Bach: An Eternal Golden Braid. Kind of a book about AI, and the similarities between the three aforementioned Germans. Not so much the people themselves, but what they produced. Kind of hard to describe, when I get a better handle on it, more will be said.

If only I could get Nate's Nintendo Wi-Fi USB dongle (technical term) to work at work, I could be rocking the wireless DS, since no one seems to want to work right now. 5 day weekend coming up, I certianly don't blame them for their lackadaisical attitude. Not to mention half of the bosses are gone, as well as most of the employees, so the ones that are left are shooting the breeze.

Off to find more creative ways to kill time than talk about myself.

I have no desire to see through my old eyes anymore, anymore.
I
I
Eyes.
-alk3

Just Damn

2005-12-13T14:31:00.000-06:00

The most depressing piece of journalism related to the future of My Fair City(tm).

Just Damn

If the NY Times removes the op-ed piece from the free section of their website, I'll just post the whole thing, It's just so blunt. Even though they look at it through their anti-Republican filter, you can't deny their charges.

Free Jazz

2005-12-08T13:48:00.000-06:00

Not the style of jazz, cause I don't know enough to talk about that, free jazz as in free beer. Angeli has been hosting various local, and sometimes not so local jazz artists that are floating around NO. So for the price of a Guinness or a Lucifer Special, one can be treated to some great music. I love my city.

I can't wait to move to my trailer in Algiers. Yeah, I said it. Living in a trailer. On the westbank. Anything is better than living the white flight existence of living in a fucking subdivision in Baton Rouge (Highland Creek: A Restricted Subdivision) and commuting to the city everyday to make a buck. I feel like shit for all the gas we waste for all the regular reasons.

"If you buy gas, the terrorists WIN."

When I come back to the city, oh yes, there will be a party. A trailer trash party. At my new home, the trailer. Am I being redundant? It shall be on like the proverbial Donkey Kong. Wifebeaters in winter, this will truly be the OMGWTFROFLBBQ.

The network is breaking down at work, and while I'm not the 'IT guy' (the proper industry term for the guy who does that stuff) i tried to get it back up yesterday. I had to go into the ceiling, dropping massive amounts of itchy insulation onto my neck. Sucked the big one. After that I kind of stopped trying. Insulation reminds me of working in fiberglass, Now I'm pretty much just typing to kill time so I'm going to go. Don't want this thing to be one of those laundry list blogs where I just regale people with anecdotes about how interesting my experience at the laundromat was.

:::Posting this as my "network test"::

Move, Forward.........

2005-12-02T10:22:00.000-06:00

To the future!!!

Writing this from my laptop on the corner of Magazine and Girod. What's the name of the wireless network I'm using? CityOfNewOrleans bitches!!! The 1st municipally owned wireless network EVER. Welcome to the future, won't you join me?

peep

http://www.boston.com/business/technology/articles/2005/11/29/new_orleans_to_deploy_free_wireless_net_system/

this for a more even handed explanation of the ins and outs. I can't contain my elation. The Postal Service makes me happy, and coupling that with discovering that a better New Orleans is already here, I can't even make regular sentences. Much less use HTML. I apologize.

weeeeeeeeeeeeeeeeeeeeeeee.

Arkansas.

2005-11-21T17:33:00.000-06:00

Sometimes high school classes were just so boring that I couldn't help but fall asleep. The absolute worst though was when I would tell myself that a study hall period was scant minutes away, and if i could just stay awake through Mr. Leutzelschwab's 47th diatribe about Whirling Dervishes, I would be rewarded with high school style naptime, Study Hall. But when I entered the room prepared to sleep without fear of reprisal, sleep would not come. Impossible. It always seems to happen that way. Even in Arkansas.

14 hours of driving, including a 2 hour diversion changing a fan belt on my father's car so we could continue the drive. I stayed awake the whole time, as my navigational duties were terribly necessary for US Highways were the roads of choice on this trip. Towards the end of the drive, I started to doze off. Anticipating the waiting room chairs as my bed for the evening, I told myself to wait until I could sleep with a good conscience. But when I got to the hospital, the sleep would not come. Even when I stole a couch in one of the other rooms in the hospital, it still took a good while to actually get to sleep. I really hate when that happens.

Now I have a new sobrina. I am two times the tio. tio times two. J = 2*tio.

Mario Kart DS. If wireless go-kart racing with cats from around the world doesn't tickle your fancy, then you must not like videogames. It's obvious Nintendo has a hard-on for hardware that looks strikingly like what Apple hardware would look like if they made videogame systems. Their approach to UI's when it comes to internet connectivity is also a Xeroxed page out of the Apple UI bible(a shiny quarter to the one who can tell me why I said Xerox and not photocopied. Think context). Keep it simple. Make it work.

Man does it. 5 minutes in a home I wasn't even sure had wireless internet and I was connected. I beat the pants offa some fool with a Texas A & M logo as his emblem. Yay me. If Nintendo keeps this up, I might start being less scared about the Solid White Nunchaku that are on the way.

Who knows.

She doesn't have to have her Young Fresh Fellows tape back now. But there's not a lot of things she'll take back.

Nighttime 'do not operate heavy machinery' medicine is on the horizon. Good night.

Has it been almost a month?

2005-10-21T05:42:00.000-05:00

Damn. Time flies in the BR whilst playing copious amounts of WoW.

DOOM(the film) is the best first person shooter I never played. I really think videogames are desensitizing me to gore and whatnot, because I COULD NOT STOP LAUGHING. Frickin heeelarious. The movie was way over the top, which I shall attribute my immense laughter, so that I don't sound like a crazy. This damn movie was so true to the Doom videogames, most of the end is in first person mode, and all you see is the gun at the bottom of the screen, bobbing along, FPS style. If anyone was as dissapointed at Land of the Dead as I was, go see this film. I can't believe I'm typing that, but I'm serious. A seriously gory action pic, based on equally gory videogames, just don't go to the midnight show with a squeamish girlfriend.

LSU Comp Sci is laughable. That is all on the school front. What's OOP, they ask? ::shudder::

Time for sleepy. Stay tuned though, because I will pretend this blog is school (probably get more out of it than that football school anyway) and talk about 2nd person narration!

Same Bat-time, Same Bat-channel.

BTW, Halloween Party up in mah hizzle the Saturday before the Hallows. I may or may not be Adam West.

Pr0n

2005-09-29T21:44:00.000-05:00

"The difference between Porn and Art is the lighting" - Ron Jeremy

The Hedgehog. Ron Jeremy. At LSU. If this school keeps this shit up, I may enjoy my short tenure at this place. If this thing was at the Cox Center, where I have Wi-Fi, I'd feel like a real-live blogger, writing about things in the present-tense and whatnot. He's debating about the good old pornography, and the other guy (don't ask me his name) is debating the flipside. I really don't know the other argument too well, so forgive me for not describing it. I should have more to say once this thing gets rolling, so for now, a tangent.

Historical Fiction. Love them segues. Quicksilver by Neal Stephenson is set during the scientific revolution of the 17th century and the invention of 'the calculus.' Newtonian vs. Leibniz-ian. Didn't even know there were two of 'em. Very interesting, for one of those page-turning, long-winded, best-selling(over-hyphenated?) books. It brings the scientific revolution to life in a way history books never do. All that accuracy never makes for good narrative. That's why the History Channel is Entertainment(big E), not science.

A tangent within a tangent. I must have nothing to say.

Back to the porn debate. Michael Leahy, the anti-porn guy, is a self diagnosed sex-addict. Claiming that his 'front row seat' to the development of the porn industry over the internet, working at IBM, turned him into a sex-addict. It's very interesting to watch Ron Jeremy as this guy gives his opening remarks. Listening intently, he is taking notes like a serious debater. Apparrently, Ron has a B.A in Theater and Education, with a Masters in Special Education. Impressive.

The rest of this post is being compiled after the fact with some neat snippets I wrote down in a text editor.

Both had some great quotables during the debate. As a rebuttal to the Leahy, Ron Jeremy claimed that one can get off to more than porn, citing masturbating to Gilligan's Island as a kid. Jeremy also claimed a strong edict of self-governance in the porn industry. Mr Leahy disagreed here citing the internet as area of focus for the hardcore that the traditional porn empire doesn't touch.

Despite Leahy's insistence on spouting douchebag motivational speaker drivel like "own your value system" and "think of intimacy as 'in to me, c?'" he wasn't all bad. He claimed to be anti-censhorship, and 'all about openness.' I think he, like Ron Jeremy, was a strong proponent of the family as the most important way to inform kids.

For the most part, everything Michael Leahy said was pretty common sense. He never really explained his platform really well besides admitting being a sex addict. He railed against porn for the way it makes one objectify women, but never answered to the fact that millions of people consume porn yet don't cheat on their wives or become sexual deviants/addicts. Overall, I think porn is good, so some guy who 'lost his wife to porn' really wasn't going to sway me.

BOOBIES

Another Ron Jeremy Quote to finish this off : "John Holmes went from having sex with gorgeous women, to doing herion and gay porn, I call that a 'Bad Career Move!'

Chancellor Ryan Is Love

2005-09-20T10:08:00.000-05:00

The other day(the 16th) I was composing a blog entry from the hallowed(...) halls of one Dodson Auditorium. I proceeded to lose my entire post but, it being one of those posts I could do without, I decided not to try and resurrect it. I was sitting in this smelly auditorium waiting for a lecture on Globalization (big G) and Language Vitality to commence. Once the Marcella arrived though, I remembered the Chancellor of my fair university was to be doing a spot of talking at the Cox Communications Academic Center for Student Athelets(redundant?), more specifically in the E.R "Bo" Campbell Auditorium. I know, it's a mouthful of advertisement and alumnus plugging you'd never see at UNO, but alas, LSU is rife with it.

Tim Ryan proceeded to elaborate on the status of the campus, the fact that his house is under 10 feet of water, and even reassured someone that if a high level Poli-Sci class would not be taught this, or next semester, that he "knew enough about politics to teach the course." Truly charming in the wake of disaster. I left impressed and safe in the knowledge that UNO was in good hands. And I got a free t-shirt! Oh, UNO, why do you spoil me so? I just love wearing a gray shirt with a pirate on the back in this blinding sea of yellow.

In other news, my stay at Casa del Campbell, Adam and Erin's house, will end very shortly. We, Marcella, Ed, Jamie, and I managed to get a four month lease on the place we'd been eyeing. I guess the landlord had one ounce of sympathy in his cold heart, considering that he tried to snake us into a year lease at first, KNOWING that we were refugees. Criminal. Or at least it should be. They watch for price gouging on gas and essential items during times of crisis, WHY THE HELL NOT HOMES???

Ah well, time for class. Computer Science is a waste of my time at LSU. Please look at the textbook required for this class.

"C for Tigers?"

W
T
F

Serrisly.

WoW Is A Feeling

2005-09-18T13:05:00.000-05:00

I am officially on da crack. Taking a nod from the one called N to the S to the P, that's Nathan Scott Phillips for the ill-informed, who decided the best way to deal with the grief over a lost home was to buy a DS, I bought my own copy of World of Warcraft. It never floods in Azeroth. So that's good.

The problem I see on the horizon is the Mac compatibility of 'teh WoWZ'. Mobile WoW. LSU wireless. All these things come together to effectively end my life. It's over. Like the 3rd season of Chapelle's Show. Over.

On another note, the 4 people who read my blog need to Buy More Beer. It's for a good cause. I know how weird that sounds, but follow the fucking link and you'll see. And for those that don't love Abita, buy some for someone who does. Massive. Totally Massive. Booyakasha.

Simple sentence construction is the theme for today's blog. My brain must still be on WoW chat mode. I really had to clean out the cobwebs last nite at a pool bar to be able to speak to people about real things. And play, gasp, analog games like pool. I really suck at pool, but the three games Rob the pilot and I played we won, oddly enough.

The siren call of teh wow calls me. no time for love dr jones

FEMA: Not As Evil As X-Files Wants You To Believe

2005-09-13T14:17:00.000-05:00

Well snap. This is the first time in my life the federal government has given me something to be happy about. Two G's. Not really much of a consolation considering the potential damage my house has sustained, but still. At least I can buy textbooks for class at a school I hate, and get an apartment in the city I hate. For those playing the home game, I'll give ya a shiny new penny to guess to where I'm referring.

There's some craziness going on in the national scale concerning the future of my once great city. The ill-informed speaker of the hizzouse, Dennis Hastert, wants to bulldoze 300 years of history. Some people in the news can't stop writing apocalyptic articles about how New Orleans will not come back(I'm linking the referring blog because the Washington Post requires registration). The link pretty much sums up my feelings on the matter as well. The city WILL come back. It will take some time.

The truth of the matter is, the city needed something to get it out of the slump it's been in since we missed the boat called economic development some 40 years ago. My house is gone. The recent levee break near my fair school may further prevent me from returning to my wonderful Computer Science department. Fine. But I will go back. What the fuck does everyone expect us to do? "Oh well, my home had it's fair share of problems mixed with a bevy of history unseen in the rest of this Great Subdiveded Plain. So what? I'll just make a new life for myself in whatever shithole I evacuated to!" Fat fucking chance. I didn't notice a great exodus of old farts and Cubans from Florida evacuating last year after 4 FUCKING HURRICANES hit that long ass state. And all they have there is Disneyworld and coke.

Honestly, I've considered leaving the state after I get my B.S in C.S. But that's leaving on my own terms. I had a plan to graduate from UNO (not on time mind you) and then figure this business out. And some stupid storm with a name like Katrina isn't going to change that.

Katrina could destroy my comics and my records, but not my home, or my sense of attachment to it.

Something Awful Is Right

2005-09-05T10:41:00.000-05:00

The internet makes you stupid. About halfway down the page, some asshole named matthasaproblem. I just finished reading about 7 pages of a penny arcade forum thread entitled 'Hurricane Katrina.' I never read the penny-arcade forum. I actually hate most web-forums. The basic structure of a forum thread, If I may: Some asshole espouses some crazy, off the wall idea in an attempt to get noticed in the sea of other stupid comments, pictures, and links to so called funny videos. He then has to defend his claim in an attempt to not lose face in his imagined community that he has invested so much of his valuble time residing in.

To make oneself noticed on the internets, one must not be marginal. Shit look at my little corner of the intertron3000. All I get are spamblog comments.One must also not be 'traditionally extreme' in an attempt to get noticed. (i just made that phrase up, but i like the shit out of it) You know the types, the racist websites, terrorists websites, I hate my life and am going to blow up my school websites. You truly have to spout some insane drivel to get noticed. Or be Wil Wheaton. That seems to work too.

I never read the penny arcade forum specifically because I don't feel the need to read what other assholes who like penny arcade like i do have to say about games or current events. It demeans the site. The writer of PA continually impresses me with his ability to 'bring the funny' on the news side of the site. And to read the forums after reading good prose would be like dosuing a delicious meal in ketchup. (This is me, with teh s uck metaphor)

I guess I just wanted to get another view on the Hurricane situation from some fellow dorks. Seeing tech related news about the hurricane from /. hammered the gravity of the situation home much more than seeing pictures of the Iberville projects on fire on CNN. These are my people, one would think. I've been starting to think for years now that dorks are some of the most opinionated people on the planet. I am no different. For years, I blasted the choice of an Apple platform for computing simply because I thought they were for 'stupid people'. I try to curb my hyper-opinionated tendencies, but often they get the best of me. Most dorks have absolutely no sense of tact, so any attempt to mellow out their beliefs in the face of people, is non-existent. And considering Professor Gabe's Greater Internet Fuckwad Theory:

There is no hope for the forum. As a means of discourse it should be stopped.

See how this thing started out as a Hurricane related post, but I meandered into a blast session on the entirety of dorkdom via their means of communication? I have the attention span of a ferret.

Baton Rouge Is The New New Orleans

2005-09-01T16:49:00.000-05:00

Damn. Hurricane Katrina. A name like that shouldn't go down in the history books as the one who felled New Orleans. But it will. I know I am a serious latecomer to blog my thoughts about the hurricane, but considering I LIVE BLOCKS FROM LAKE PONTCHARTRAIN, I think it could be forgiven. Being a refugee has never felt this swank. If I were to describe my relation, or non-relaton to the person I am staying with, it would get very confusing. Suffice to say I am in the gated community inside Baton Rouge known as the 'Country Club of Louisiana.' For a refugee, I am doing okay, I think. I think I might be staying here to finish my semester from UNO at the wonderfully sprawling campus of the Louisiana State University(LSU). Dunno.

This whole thing hasn't really set in I think. I have no home. All my stuff is gone. So what? I never used it anyway. I'm filling out a form for FEMA disaster aid right now that will probably prove fruitless, but who knows. 'A million pounds of ice, says the president.' Why? TO COOL OFF THE GULF SO WE DON'T HAVE SO MANY HURRICANES NEXT YEAR?!?!?! Thanks a pantsful guy. He can't even conduct a war successfully, so how am I supposed to expect him to take care of my city? The Consciousness Stream(tm) is particularly weird right now. Must be the glee from being so close to the internets, nay ELECTRICITY! It sure feels good to be in the A/C again. I'll be back later to blog some more, but I've really gotta look at some pictures of Lake New Orleans so.........

Payce

the next time you see me i will have a refugee beard.

Word Verification Is Where It's At, Y'all

2005-08-26T19:23:00.000-05:00

I turned on word verification for the illusory people who read my blog and don't comment, and the goddamn spam bloggers. Seriously, under the post 'Bill Gates is Gangsta' there was a comment like, "I definitely wanna read your blog! It's cool and informative! While you're at it, check out my blog about Swimming Pools and Chemicals! I really like Swimming Pools and Chemicals!"

Jeez. That just burns my britches. Now I know it's nothing but scripts crawling the web reading my drivel. That sucks.

I've been reading this book called The C Programming Language to get boned up on C and all it's derivates in hopes Google will do the Summer of Code again next year. I've been meticulously doing all the exercises in the book to get my feet wet with just hammering out code, since UNO doesn't do much in the way of teaching you syntax, more of the design philosophy. Which is rockin, don't get me wrong, but I need more learnin on that syntactical tip, y'dig? I was stumped on one of the problems and went to a very fine website that had answers to all the exercises to get an idea of how to proceed. The only problem is that one of the answers has this big string of nested conditionals that just throw me. Maybe it's the language itself, but it just seems sloppy after coming from Dr. Niño's classes. Small conditionals he stressed CONSTANTLY. So I just have to get used to seeing it from other people I guess. Really I'm writing this as a procrastinational exercise.

Avoiding things I'm doing independantly from school for my own betterment. I think I'm just a special kind of lazy. And it sucks. Payce.

Whoa Buddy

2005-08-23T14:02:00.000-05:00

Pat Robertson is not known for saying the most intelligent things. So why should his opinions on the foreign policy of this troubled nation seem strange given the amazingly racist, sexist, bigoted things he's said before? I think the 700 club is just turning into Jerry Springer or something similar, where people tune in just to hear the messed up things people spout on national television. But the fact that it's coming from a christian conservative who once ran for the Rebublican party's nomination for the Presidency, it really scares me. Because people are bound to listen to him. And the really sad thing is people think he is representative of the Republican party. Ill-informed toward social issues, a ethnocentric view on other countries and their non christian religion, I didn't think people could go through college and still be this ignorant. And the scariest part of all, he had an awful lot of school. Enough for a freakin juris doctorate from Yale!

This man gives the Republican party a bad name. Some would say they already have a bad name, but he just makes it all messed up. I'm the kind of Republican who believes in a 'conservative' approach to the scope of power of the government. Weird I know. To me, an ethos of less government cannot coincide with an edict, handed down from God or whatever, to police morality. It does not compute. And this Libertarian party is not the right answer to Crazy Christian Conservatives(tm), it only turns the party over to the crazies. Like 1988 Republican Presidential hopeful Pat Roertson. I'm sure the idea of that man as Pres makes Dubya seem like a master statesman.

It took a call for assassination from the right to get me to post after 4 days of absence. Thank you Pat, you inspired me to such anger, I had to take it out on my keyboard, by typing this directionless spurt of anger at the quality of education at a certian Ivy League school; one that could produce a crazy like you Pat. So much for a liberal education from the east coast, eh?

Bill Gates is Gangsta

2005-08-19T14:21:00.000-05:00

Robert Burke over on Blogcritics.org apparrently has more time on his hands than is good for him. He has compiled a list of all the rap songs that mention Bill Gates. Pretty funny stuff.

Blogging has officially reached the mainstream as well. All you real bloggers (who don't read my drivel) are FIRED! Donald Trump has a blog! That Donny is a hoot. Now alls we need is for Bill Gates to have a Gangsta Gates Blog. Oh that would make my heart sing.

I really don't have much else to say, I just had to get that link service off my chest. They've been chilling in tabs on Firefox since probably Wednesday. I don't have the motivation to go out and get riled up about something to write about it. So off I go to prepare for the Google Summer of Code 2006. My C skillz are not that of 'teh mad haxxorz' so I must get better if I want to spend my summer working in the wonderful world of OSS. For money.

Besides I think Dr. Jaime Niño laid a good groundwork for learning to design software, I just need more practice. So yeah. Enough talking to myself.

Edit:
New Linkzor:

I swear the bathroom in this damned place has got to be worse than the ones in Guantanamo Bay.

But that's not the reason i'm here. It appears Tycho of Penny-Arcade fame is going to be a father. But that's not even the coolest part. He starts the post containing this wonderful news with a World of Warcraft reference. Many geek points from the non-WoW playing camp.

Some Kind of Arrogance

2005-08-18T12:40:00.000-05:00

It appears that Microsoft believes it is the alpha and omega when it comes to software. Forget what you, my fair nonexistent readership, have heard about MacOSX being the bomb diggity swerve; forget the fact that until last month Windows did not have an answer to any hardware vendors and their 64-bit processors; in fact forget this article too, written in 1998. They weren't innovating then either.

Mactopia. Apparrently Microsoft thinks their tiny corner of the web is the Utopia for Mac users.

Mactopia. Fucking rididulous. A quick browsing of the front page makes me think Microsoft has fooled themselves into thinking they have a superior solution to the 3 things most pedestrian computer users use their machines for.

Web browsing - Internet Explorer 5 for Mac. I can't believe it. PC users are jumping ship in DROVES in favor of Mozilla Firefox over IE, and they think Mac users are going to want to get back in that leaky boat? Safari (the Apple standard browser) is built on KHTML, a standard developed for the open source web browser Konqueror. Firefox is built on publicly-released-after-the-demise-of-Netscape source(OSS). Is it any wonder that these programs are safer than IE?

'Office' applications - Microsoft Office for Mac. I think MS is hiding their head in the sand on this one. OpenOffice is probably a bad word on the Redmond campus. Bill Gates once wrote an open letter to hobbyists. In it he makes the case for proprietary software, so I know how he feels about open source software.

Chat software - 'instant messaging.' Microsoft Messenger for Mac. Being a latecomer to yet another application that people rely on regularly in their daily lives, MS now offers their 'messenger' service for Mac users. Honestly, this is the category where Apple has satisfied me 'out of the box.' iChat roxxors. It does what I want, and it appears that GAIM, yet another open source app I use on my Windows box, is modeled to look like it. So yeah, I dig it. But on the Big Brother tip, I'm just plain scared of the .NET framework that MS requires you to install to use their Messenger. A PASSPORT? For the internet? Scary.

Making a list is a really good way to relieve stress. I feel like I did something. However useless, since no one will make good use of my awesome link service.

The Underground Breakfast Sandwich Railroad

2005-08-17T08:34:00.000-05:00

So yeah, I smuggled an Egg McMuffin away from it's oppresive stay in the main office. Given to me by my contact on the inside (the secretary), she had acquired the stray Muffin from the vile Quality Assurance Manager. She insisted I save the sandwich by smuggling it within my pants to the greener pastures of the Parts Room. Always an adventure at Otech.

I'm a regular Harriet Tubman up in this piece.

I watched The Man Who Wasn't There on Sunday. Amazing. Simply, freaking, amazing. Neo-noir is like good punk rock. Most punk bands who started the punk movement were terrible musicians, I wouldn't even call anyone in the Ramones a 'musician' since they are just so bad. But, all the kids who grew up on a healthy diet of bad punk, the ones who wanted to learn how to play music, wanted to emulate their idols; but invariably, they had more of the musical 'chops' and ushered in an era of punk that's not only fast and energetic, but well composed and more intricate than the three power chord crap that was so popular to early punk (still is). Even bands like The Mr. T Experience and Screeching Weasel, who sought to emulate the Ramones, sound better. It's like they just can't help not sucking as bad.

And now that I've carried the neo-noir as punk rock analogy waaaaaaay too far, it's time to reel it in. I don't have a tremendous amount of respect for many early films. Static camera techniques, mediocre writing, and not to mention the terrible acting. I have no love for, to use a comic book phrase, the Golden Age of film. Granted the medium was new, and there are many gems, the majority are just bad. Take the early Hitchcock noir film Shadow of a Doubt. A sophmoric conception of the psychology of a serial killer coupled with Hitchcock not fully realizing his ability to create suspense, it's just plain bad. And it had so much going for it....

Man, I am just in a tangental mood today.

Back to The Man Who Wasn't There, it's the Coen brothers rehashing the classic black and white film-noir style, with their filmic 'chops' front and center. Any film shot in the fifties doesn't have to place itself in time if it is 'contemporary', at least not in obvious ways, not to mention the limitations on what filmmakers could get away with back then. The Coen brothers use obvious historical cues to place you in time, and it serves to paint an interesting picture of the time, the observer looking back. The camera work is absolutely wonderful. I read somewhere, maybe IMDB, that they shot the film in color, and de-colorized the film. Dunno if that's true, but the film certainly looks vibrant. Great use of shadow (it's called noir for a reason), the film has it's share of starkly lighted scenes, yet some scenes manage to use many middle grays. Billy Bob Thornton is wonderful as the barber drifting through the American Dream. I cannot say enough good things about it.

Sometimes the homage can be more significant than the original piece one is paying homage to.

Neo-Noir is so punk rawk.

Apple: It doesn't have solitire

2005-08-11T16:06:00.000-05:00

Found an awesome ad from a Wizard magazine during the bombardment of Apple Switch ads across all forms of media.

it's nifty, here it is:

I have a kind of strange facination with these Apple ads. I don't really know why, they used to bother me to no end. Stupid people talking down to stupid pepole proliferating the great unwashed computer idiocy that we face today. "GET RID OF SPAM" they say, "I HATE POP-UPS", but what they refer to as popups sometimes might actually be REAL messages the computer is trying to convey, but it gets in the way of their dirty Internet Exploder browsing of the intertron.

I don't mean to go off on a tangent, but suffice to say, they weren't speaking to me, yet it offended me greatly. Now they are almost a novelty to me, and I find them heee-larious. This one has been on my mind since Monday, I tried to find it online, but had to settle for scanning it at work. I didn't bother cleaning it up because i'm lazy. Apoligies to the imaginary people who read this blog.

DR DOOM MADE THE SWITCH!!!

And now for a trip in the wayback machine

2005-08-10T13:40:00.000-05:00

I found this post about Amerika in my old /. journal. I used to use that before I found out about an entirely new way to publish my thoughts that would still remain unread by everyone. But still, I wanted to put this bit o' business on here since I kind of got off track while talking about Amerika the last time. So without further ado, here it is:

from /. Wednesday, July 13 2-double-aught-5

Two lines from Kafka's Amerika really stood out to me when i read them recently. As Karl is walking away from New York along the road, the line "The occasional automobile shot out of the fog, and all three turned their heads towards these cars, which were usually enormous and so striking in appearance and so fleetingly present there was no time to notice whether they had any occupants or not."

It is amazing how precise Kafka pinpoints a feeling of awe and wonderment at the sight of an American automobile whizzing by a pedestrian on the road. It calls to mind the oversized "space age" cars we Americans were so fond of during the fifties and sixties; yet this book was written years before, and by a man who never even visited the US. Kafka writes in such a way as to make the normal seem surreal, not in the same vein as Gabriel Garcia Marquez with his fantastic realism, but in an uncanny manner, the simple act of a car passing on the road becomes an event, a large imposing symbol of American ingenuity personified.

The second line comes after Karl realizes that it will be harder to leave the US if he is in the interior of the country rather than New York. His traveling companions convince him to continue away from the city and it reads "Even then he wouldn't have gone if he hadn't told himself that it was probably better for him to go to a place from which it would be less easy to return home. It would be better for his work and his general progress, if he had no useless thoughts to distract him."

That line is particularly telling about the character and his work ethic. Being distracted by alternative prospects is undesirable to him. His desire, it seems is to be locked into a situation so as to attack it head on, certainly an interesting way to approach life.

BAM!

Killing Time, Killing Time

2005-08-09T13:25:00.000-05:00

I've never been a proponent of flash games as a Great Impediment To Productivity(tm), but this puzzle Grow had me baffled for a good while. Nifty for a puzzle game, makes me wanna play Myst or something. Maybe i'll jack it from the Chan's server.

School cannot start sooner. This vacation is killing me. I know I'll be resenting these words when school starts and the big programming crunch hits, but still...I need an excuse to stop going out and spending money and staying out late. School has never been a reasonable excuse for me, but I'm going to try my damnedest to make it a viable excuse. I swear, if Buddah's brother Gianni finishes school before me (he starts in the fall) I just might have to shoot myself in the face.

Back to work, ya bastard (the bastard in question being me).

sucks

2005-08-04T15:18:00.000-05:00

I wrote a bunch of crap about how i liked my laptop as a Unix Box(tm). But i lost it. Here's what it looks like. I like it. Woo.

Just pretend this entry is from saturday, 30th

2005-08-01T10:22:00.000-05:00

I guess my neighbor's interweb connection isn't being as generous as I would like, since I am having to type this in TextEdit to put up later. Bastard. It's really hard to get back into the swing of programming. Slowly I trudge through the ancient land of the mighty C. No plus plus after that or anything. Good old C. The language of UNIX. I tried to invoke the GNU C Compiler in the Mac OSX terminal, and was sorely denied. I really need to unlock all the UNIX goodness laying underneath this pretty Aqua interface. I'm looking forward to this next semester of Comp Sci goodness, if only to give me direction in my learnings. I feel easily distractable and it really bugs me. I need the focus of a class to pull me out of this drifting slump.

Case in point, I typed the above days ago, and am just now getting back to it. I can't even focus enough to 'blog. Sweet Christmas, that's depressing. At least I have seaweed salad for breakfast. But nothing to drink but sake. I'm like a prisoner in my own home if I wake up before noon on the weekends. Marcella sleeping in my room, not to be disturbed, my Mother taking a NAP at 9:30 in the damned AM. Apparently four hours of waking are too much to take on this wonderful Saturday. Below me the sounds of whatever British moron is "investigating" the bible this week on the tele. I can't venture to get even a glass of water, as there are sleeping guards at the gates. My hyperbole is showing.

I finished The Stranger today, the book, not the movie. Depressingly lovely. Life is pointless, and there is no reason to change your lot in life since you die anyway. Oh good, someone is awake, now I don't have to drink sake in the morning. The book really impressed me. I don't really agree with the philosophy, but that's not really the point anyway. Philosophically infused fiction is kind of alien to me, but it's a lot less abrasive than essays on philosophy are. Nifty. I think I will look for more.

I Start My City With a Brick

2005-07-29T14:07:00.000-05:00

Add another brick,
Brick by brick i manufacture homes for fallen angels.
-Aes Rock

I've been working in this here parts room for going on 4 years now. NOT ONCE have I dropped the contents of a bag of nuts or washers or the like onto the floor rather than into it's respective bin.

UNTIL TODAY

Man, it really sucked too, had to get on the dirty ass floor and pick up as many damned nuts as I could find. Way dirty.

I really thought The Stranger was a pretty disappointing piece of liturature until around chapter 6. I had visions in my head of college english types grasping for a reason this thing was any good at all. It read like a freakin' fourth grader wrote it: "I walked to the balcony. I had a cigarette. I am wearing Spongebob underwear. I watched the people below me with interest, maybe."

But as I was reading today, all of a sudden it got really freakin good.

"He asked me if I wasn't interested in a change of life. I said that people never change their lives, that in any case one life was as good as another and that I wasn't dissatisfied with mine here at all."

I'm sure there are plenty more lines like that, or alluding to ideas like that earlier in the book, but I was probably looking at it with too critical of an eye, being that it was such a renowned work. I need to stop doing that, but at least I come to the conclusion that I like the book on my own terms. I'm not too boned up on existential philosophy, but i'm sure this has alot to do with some of it's core ideas. Regardless, I am now digging it. Digging it I am.

I'm wondering if Garden State had some influences from Albert Camus. The main character's complete lack of feeling at the funereal of his mother, the way that he just kind of drifts through life doing things because it's something to do, rather than out of a desire to do it. I wonder if Zach Braff has acknowledged it as an influence, at least as a jumping off point. Dunno. Must watch Garden State special features.

Note to self (since no one else reads this shite anyway)

PLAY MORE DAWN OF WAR.

Kafka is so Kafkaesque

2005-07-27T13:52:00.000-05:00

I love saying that. It reminds me of that episode of Mission Hill where what's-his-face makes a comic ala The Far Side with a caption "That is so Kafkaesque" when it is obviously NOTHING like Kafka!!! ahahahaha..... "It's supposed to be a commentary on people who say Kafkaesque and don't know what it means" he says. Wow. Amerika was a good book (the master of segues right here). Like the Trial, Amerika was wholly engaging, and utterly maddeningly unfinished. Damn Kafka and his second-guessing-itis. "Necessarily endless" assholes in liturature have been known to say things like that about his obviously unfinished works. I guess they say shit like that to make themselves be okay with the idea of reading the work of a dead man published against his will.

But I do think there might be a bit of truth there. When I finished The Trial, or actually when I finished the penultimate chapter, I was left flabbergasted. That's right, flabbergasted. I didn't know I was reading an unfinished work. So to my suprise I'm settling into a very climactic chapter and BAM i get one of these:

**This chapter was never completed**

WTFOMFG&%$#!*@ Is an approximation of how I felt and continued to feel for a good half of an hour, reflecting on the two ways the book could have gone. I don't remember exactly what I thought were the two alternate paths the book could have taken, (which is probably the best explination of why I use this damned blog thingy now) but i came to the conclusion that it was better to leave the chapter ambiguous. It fit with the whole maddening tone of the book, I said. Maybe that's true, or maybe I'm another one of those assholes who makes assumptions about things never meant to be published. But I thought about that when I was reading Amerika: The Man Who Disappeared today; as I got into the section of the book labeled fragments I began feeling uneasy, as if the parts I was reading were some kind of deleted scene, but with Kafka they kind of hang in the air a bit, ethereal. I became unsure of where the original translation ended and this one differed. I itched to read the introduction to satisfy my curiosity. Things began distracting me from finishing the unfinishable. I

**This post was never completed**

SAKE

2005-07-25T00:41:00.000-05:00

SHO CHIKU BAI!!!!!!!!!!!!!!

I did not intend to drink all this sake watching b5 and eating wheat pasta on a sunday night. snap.

Trust No One

2005-07-25T00:11:00.000-05:00

Can't Hardly Wait is a goddamnd funny movie. Seriously. I was in the middle of watching a bit of the B5, but it warranted my utmost attention. And B5 is in the middle of getting way good. TVONDVD(tm) is so amazing. The show is widescreen, commercial free, and you don't have to wait a summer for season finalés. Television at it's best. Being that I am a bit sake drunk right now, i'm sure that this is plain piss i'm typing but fuck it, no one reads this thing anyway. Kind of like my /. journal, pretty much for me only.
The Marce is officially obsessed with Babylon Five, and I couldn't be happier. It's almost like when she got into the good old strat rpg, even though she hates rpg's. She HATES the trek, so a B5 seems like a Trek with lower production values, and slightly worse acting. But the overwhelming fact is that besides the shitty sci-fi accouterments, it's way good underneath. The characters are more than base-line archetypes and the setting is sublimely flawed, unlike the aforementioned Trek. That perfect communist space party always sat bad in my mind. I think I just have no faith in humanity's ability to advance that far in a few short hundred years. This post is completely drunk stream of consciousness and i can't retrace the thread of this nonsense right now, so I go. Off to sleep.
Payce

Oh jeez

2005-07-20T15:55:00.000-05:00

Testing. I don't know where my facination with this "blog/online journal bizness" came from. Jeez, I used to make fun of people's LJ's, but the funny thing is, NO ONE I KNOW IS ON BLOGGER. Therefore, it truly is for myself and not some exhibitionistic desire to broadcast my personal shit all over the intertron. Doesn't change the fact that this blogging thing is goofy.